Google
Web www.fiveanddime.net


This is gawkinet.info, produced by makeinfo version 4.6 from
gawkinet.texi.

INFO-DIR-SECTION Network applications
START-INFO-DIR-ENTRY
* Gawkinet: (gawkinet).         TCP/IP Internetworking With `gawk'.
END-INFO-DIR-ENTRY

This is Edition 1.1 of `TCP/IP Internetworking With `gawk'', for the
3.1.4 (or later) version of the GNU implementation of AWK.


   Copyright (C) 2000, 2001, 2002, 2004 Free Software Foundation, Inc.


   Permission is granted to copy, distribute and/or modify this document
under the terms of the GNU Free Documentation License, Version 1.2 or
any later version published by the Free Software Foundation; with the
Invariant Sections being "GNU General Public License", the Front-Cover
texts being (a) (see below), and with the Back-Cover Texts being (b)
(see below).  A copy of the license is included in the section entitled
"GNU Free Documentation License".

  a. "A GNU Manual"

  b. "You have freedom to copy and modify this GNU Manual, like GNU
     software.  Copies published by the Free Software Foundation raise
     funds for GNU development."

   This file documents the networking features in GNU `awk'.

This is Edition 1.1 of `TCP/IP Internetworking With `gawk'', for the
3.1.4 (or later) version of the GNU implementation of AWK.


   Copyright (C) 2000, 2001, 2002, 2004 Free Software Foundation, Inc.


   Permission is granted to copy, distribute and/or modify this document
under the terms of the GNU Free Documentation License, Version 1.2 or
any later version published by the Free Software Foundation; with the
Invariant Sections being "GNU General Public License", the Front-Cover
texts being (a) (see below), and with the Back-Cover Texts being (b)
(see below).  A copy of the license is included in the section entitled
"GNU Free Documentation License".

  a. "A GNU Manual"

  b. "You have freedom to copy and modify this GNU Manual, like GNU
     software.  Copies published by the Free Software Foundation raise
     funds for GNU development."


File: gawkinet.info,  Node: Top,  Next: Preface,  Prev: (dir),  Up: (dir)

General Introduction
********************

This file documents the networking features in GNU Awk (`gawk') version
3.1 and later.

This is Edition 1.1 of `TCP/IP Internetworking With `gawk'', for the
3.1.4 (or later) version of the GNU implementation of AWK.


   Copyright (C) 2000, 2001, 2002, 2004 Free Software Foundation, Inc.


   Permission is granted to copy, distribute and/or modify this document
under the terms of the GNU Free Documentation License, Version 1.2 or
any later version published by the Free Software Foundation; with the
Invariant Sections being "GNU General Public License", the Front-Cover
texts being (a) (see below), and with the Back-Cover Texts being (b)
(see below).  A copy of the license is included in the section entitled
"GNU Free Documentation License".

  a. "A GNU Manual"

  b. "You have freedom to copy and modify this GNU Manual, like GNU
     software.  Copies published by the Free Software Foundation raise
     funds for GNU development."

* Menu:

* Preface::                          About this document.
* Introduction::                     About networkiing.
* Using Networking::                 Some examples.
* Some Applications and Techniques:: More extended examples.
* Links::                            Where to find the stuff mentioned in this
                                     document.
* GNU Free Documentation License::   The license for this document.
* Index::                            The index.

* Stream Communications::          Sending data streams.
* Datagram Communications::        Sending self-contained messages.
* The TCP/IP Protocols::           How these models work in the Internet.
* Basic Protocols::                The basic protocols.
* Ports::                          The idea behind ports.
* Making Connections::             Making TCP/IP connections.
* Gawk Special Files::             How to do `gawk' networking.
* Special File Fields::            The fields in the special file name.
* Comparing Protocols::            Differences between the protocols.
* File /inet/tcp::                 The TCP special file.
* File /inet/udp::                 The UDP special file.
* File /inet/raw::                 The RAW special file.
* TCP Connecting::                 Making a TCP connection.
* Troubleshooting::                Troubleshooting TCP/IP connections.
* Interacting::                    Interacting with a service.
* Setting Up::                     Setting up a service.
* Email::                          Reading email.
* Web page::                       Reading a Web page.
* Primitive Service::              A primitive Web service.
* Interacting Service::            A Web service with interaction.
* CGI Lib::                        A simple CGI library.
* Simple Server::                  A simple Web server.
* Caveats::                        Network programming caveats.
* Challenges::                     Where to go from here.
* PANIC::                          An Emergency Web Server.
* GETURL::                         Retrieving Web Pages.
* REMCONF::                        Remote Configuration Of Embedded Systems.
* URLCHK::                         Look For Changed Web Pages.
* WEBGRAB::                        Extract Links From A Page.
* STATIST::                        Graphing A Statistical Distribution.
* MAZE::                           Walking Through A Maze In Virtual Reality.
* MOBAGWHO::                       A Simple Mobile Agent.
* STOXPRED::                       Stock Market Prediction As A Service.
* PROTBASE::                       Searching Through A Protein Database.


File: gawkinet.info,  Node: Preface,  Next: Introduction,  Prev: Top,  Up: Top

Preface
*******

In May of 1997, Ju"rgen Kahrs felt the need for network access from
`awk', and, with a little help from me, set about adding features to do
this for `gawk'.  At that time, he wrote the bulk of this Info file.

   The code and documentation were added to the `gawk' 3.1 development
tree, and languished somewhat until I could finally get down to some
serious work on that version of `gawk'.  This finally happened in the
middle of 2000.

   Meantime, Ju"rgen wrote an article about the Internet special files
and `|&' operator for `Linux Journal', and made a networking patch for
the production versions of `gawk' available from his home page.  In
August of 2000 (for `gawk' 3.0.6), this patch also made it to the main
GNU `ftp' distribution site.

   For release with `gawk', I edited Ju"rgen's prose for English
grammar and style, as he is not a native English speaker.  I also
rearranged the material somewhat for what I felt was a better order of
presentation, and (re)wrote some of the introductory material.

   The majority of this document and the code are his work, and the
high quality and interesting ideas speak for themselves.  It is my hope
that these features will be of significant value to the `awk' community.


Arnold Robbins
Nof Ayalon, ISRAEL
March, 2001


File: gawkinet.info,  Node: Introduction,  Next: Using Networking,  Prev: Preface,  Up: Top

1 Networking Concepts
*********************

This major node provides a (necessarily) brief intoduction to computer
networking concepts.  For many applications of `gawk' to TCP/IP
networking, we hope that this is enough.  For more advanced tasks, you
will need deeper background, and it may be necessary to switch to
lower-level programming in C or C++.

   There are two real-life models for the way computers send messages
to each other over a network.  While the analogies are not perfect,
they are close enough to convey the major concepts.  These two models
are the phone system (reliable byte-stream communications), and the
postal system (best-effort datagrams).

* Menu:

* Stream Communications::       Sending data streams.
* Datagram Communications::     Sending self-contained messages.
* The TCP/IP Protocols::        How these models work in the Internet.
* Making Connections::          Making TCP/IP connections.


File: gawkinet.info,  Node: Stream Communications,  Next: Datagram Communications,  Prev: Introduction,  Up: Introduction

1.1 Reliable Byte-streams (Phone Calls)
=======================================

When you make a phone call, the following steps occur:

  1. You dial a number.

  2. The phone system connects to the called party, telling them there
     is an incoming call. (Their phone rings.)

  3. The other party answers the call, or, in the case of a computer
     network, refuses to answer the call.

  4. Assuming the other party answers, the connection between you is
     now a "duplex" (two-way), "reliable" (no data lost), sequenced
     (data comes out in the order sent) data stream.

  5. You and your friend may now talk freely, with the phone system
     moving the data (your voices) from one end to the other.  From
     your point of view, you have a direct end-to-end connection with
     the person on the other end.

   The same steps occur in a duplex reliable computer networking
connection.  There is considerably more overhead in setting up the
communications, but once it's done, data moves in both directions,
reliably, in sequence.


File: gawkinet.info,  Node: Datagram Communications,  Next: The TCP/IP Protocols,  Prev: Stream Communications,  Up: Introduction

1.2 Best-effort Datagrams (Mailed Letters)
==========================================

Suppose you mail three different documents to your office on the other
side of the country on two different days.  Doing so entails the
following.

  1. Each document travels in its own envelope.

  2. Each envelope contains both the sender and the recipient address.

  3. Each envelope may travel a different route to its destination.

  4. The envelopes may arrive in a different order from the one in
     which they were sent.

  5. One or more may get lost in the mail.  (Although, fortunately,
     this does not occur very often.)

  6. In a computer network, one or more "packets" may also arrive
     multiple times.  (This doesn't happen with the postal system!)


   The important characteristics of datagram communications, like those
of the postal system are thus:

   * Delivery is "best effort;" the data may never get there.

   * Each message is self-contained, including the source and
     destination addresses.

   * Delivery is _not_ sequenced; packets may arrive out of order,
     and/or multiple times.

   * Unlike the phone system, overhead is considerably lower.  It is
     not necessary to set up the call first.

   The price the user pays for the lower overhead of datagram
communications is exactly the lower reliability; it is often necessary
for user-level protocols that use datagram communications to add their
own reliability features on top of the basic communications.


File: gawkinet.info,  Node: The TCP/IP Protocols,  Next: Making Connections,  Prev: Datagram Communications,  Up: Introduction

1.3 The Internet Protocols
==========================

The Internet Protocol Suite (usually referred to as just TCP/IP)(1)
consists of a number of different protocols at different levels or
"layers."  For our purposes, three protocols provide the fundamental
communications mechanisms.  All other defined protocols are referred to
as user-level protocols (e.g., HTTP, used later in this Info file).

* Menu:

* Basic Protocols::             The basic protocols.
* Ports::                       The idea behind ports.

   ---------- Footnotes ----------

   (1) It should be noted that although the Internet seems to have
conquered the world, there are other networking protocol suites in
existence and in use.


File: gawkinet.info,  Node: Basic Protocols,  Next: Ports,  Prev: The TCP/IP Protocols,  Up: The TCP/IP Protocols

1.3.1 The Basic Internet Protocols
----------------------------------

IP
     The Internet Protocol.  This protocol is almost never used
     directly by applications.  It provides the basic packet delivery
     and routing infrastructure of the Internet.  Much like the phone
     company's switching centers or the Post Office's trucks, it is not
     of much day-to-day interest to the regular user (or programmer).
     It happens to be a best effort datagram protocol.

UDP
     The User Datagram Protocol.  This is a best effort datagram
     protocol.  It provides a small amount of extra reliability over
     IP, and adds the notion of "ports", described in *Note TCP and UDP
     Ports: Ports.

TCP
     The Transmission Control Protocol.  This is a duplex, reliable,
     sequenced byte-stream protocol, again layered on top of IP, and
     also providing the notion of ports.  This is the protocol that you
     will most likely use when using `gawk' for network programming.

   All other user-level protocols use either TCP or UDP to do their
basic communications.  Examples are SMTP (Simple Mail Transfer
Protocol), FTP (File Transfer Protocol), and HTTP (HyperText Transfer
Protocol).  


File: gawkinet.info,  Node: Ports,  Prev: Basic Protocols,  Up: The TCP/IP Protocols

1.3.2 TCP and UDP Ports
-----------------------

In the postal system, the address on an envelope indicates a physical
location, such as a residence or office building.  But there may be
more than one person at a location; thus you have to further quantify
the recipient by putting a person or company name on the envelope.

   In the phone system, one phone number may represent an entire
company, in which case you need a person's extension number in order to
reach that individual directly.  Or, when you call a home, you have to
say, "May I please speak to ..." before talking to the person directly.

   IP networking provides the concept of addressing.  An IP address
represents a particular computer, but no more.  In order to reach the
mail service on a system, or the FTP or WWW service on a system, you
must have some way to further specify which service you want.  In the
Internet Protocol suite, this is done with "port numbers", which
represent the services, much like an extension number used with a phone
number.

   Port numbers are 16-bit integers.  Unix and Unix-like systems
reserve ports below 1024 for "well known" services, such as SMTP, FTP,
and HTTP.  Numbers 1024 and above may be used by any application,
although there is no promise made that a particular port number is
always available.


File: gawkinet.info,  Node: Making Connections,  Prev: The TCP/IP Protocols,  Up: Introduction

1.4 Making TCP/IP Connections (And Some Terminology)
====================================================

Two terms come up repeatedly when discussing networking: "client" and
"server".  For now, we'll discuss these terms at the "connection
level", when first establishing connections between two processes on
different systems over a network.  (Once the connection is established,
the higher level, or "application level" protocols, such as HTTP or
FTP, determine who is the client and who is the server.  Often, it
turns out that the client and server are the same in both roles.)

   The "server" is the system providing the service, such as the web
server or email server.  It is the "host" (system) which is _connected
to_ in a transaction.  For this to work though, the server must be
expecting connections.  Much as there has to be someone at the office
building to answer the phone(1), the server process (usually) has to be
started first and be waiting for a connection.

   The "client" is the system requesting the service.  It is the system
_initiating the connection_ in a transaction.  (Just as when you pick
up the phone to call an office or store.)

   In the TCP/IP framework, each end of a connection is represented by
a pair of (ADDRESS, PORT) pairs.  For the duration of the connection,
the ports in use at each end are unique, and cannot be used
simultaneously by other processes on the same system.  (Only after
closing a connection can a new one be built up on the same port. This
is contrary to the usual behavior of fully developed web servers which
have to avoid situations in which they are not reachable. We have to
pay this price in order to enjoy the benefits of a simple communication
paradigm in `gawk'.)

   Furthermore, once the connection is established, communications are
"synchronous".(2) I.e., each end waits on the other to finish
transmitting, before replying. This is much like two people in a phone
conversation.  While both could talk simultaneously, doing so usually
doesn't work too well.

   In the case of TCP, the synchronicity is enforced by the protocol
when sending data.  Data writes "block" until the data have been
received on the other end.  For both TCP and UDP, data reads block
until there is incoming data waiting to be read.  This is summarized in
the following table, where an "X" indicates that the given action
blocks.

TCP        X       X
UDP        X
RAW        X

   ---------- Footnotes ----------

   (1) In the days before voice mail systems!

   (2) For the technically savvy, data reads block--if there's no
incoming data, the program is made to wait until there is, instead of
receiving a "there's no data" error return.


File: gawkinet.info,  Node: Using Networking,  Next: Some Applications and Techniques,  Prev: Introduction,  Up: Top

2 Networking With `gawk'
************************

The `awk' programming language was originally developed as a
pattern-matching language for writing short programs to perform data
manipulation tasks.  `awk''s strength is the manipulation of textual
data that is stored in files.  It was never meant to be used for
networking purposes.  To exploit its features in a networking context,
it's necessary to use an access mode for network connections that
resembles the access of files as closely as possible.

   `awk' is also meant to be a prototyping language. It is used to
demonstrate feasibility and to play with features and user interfaces.
This can be done with file-like handling of network connections.
`gawk' trades the lack of many of the advanced features of the TCP/IP
family of protocols for the convenience of simple connection handling.
The advanced features are available when programming in C or Perl. In
fact, the network programming in this major node is very similar to
what is described in books such as `Internet Programming with Python',
`Advanced Perl Programming', or `Web Client Programming with Perl'.

   However, you can do the programming here without first having to
learn object-oriented ideology; underlying languages such as Tcl/Tk,
Perl, Python; or all of the libraries necessary to extend these
languages before they are ready for the Internet.

   This major node demonstrates how to use the TCP protocol. The other
protocols are much less important for most users (UDP) or even
untractable (RAW).

* Menu:

* Gawk Special Files::          How to do `gawk' networking.
* TCP Connecting::              Making a TCP connection.
* Troubleshooting::             Troubleshooting TCP/IP connections.
* Interacting::                 Interacting with a service.
* Setting Up::                  Setting up a service.
* Email::                       Reading email.
* Web page::                    Reading a Web page.
* Primitive Service::           A primitive Web service.
* Interacting Service::         A Web service with interaction.
* Simple Server::               A simple Web server.
* Caveats::                     Network programming caveats.
* Challenges::                  Where to go from here.


File: gawkinet.info,  Node: Gawk Special Files,  Next: TCP Connecting,  Prev: Using Networking,  Up: Using Networking

2.1 `gawk''s Networking Mechanisms
==================================

The `|&' operator introduced in `gawk' 3.1 for use in communicating
with a "coprocess" is described in *Note Two-way Communications With
Another Process: (gawk)Two-way I/O.  It shows how to do two-way I/O to a
separate process, sending it data with `print' or `printf' and reading
data with `getline'.  If you haven't read it already, you should detour
there to do so.

   `gawk' transparently extends the two-way I/O mechanism to simple
networking through the use of special file names.  When a "coprocess"
that matches the special files we are about to describe is started,
`gawk' creates the appropriate network connection, and then two-way I/O
proceeds as usual.

   At the C, C++, and Perl level, networking is accomplished via
"sockets", an Application Programming Interface (API) originally
developed at the University of California at Berkeley that is now used
almost universally for TCP/IP networking.  Socket level programming,
while fairly straightforward, requires paying attention to a number of
details, as well as using binary data.  It is not well-suited for use
from a high-level language like `awk'.  The special files provided in
`gawk' hide the details from the programmer, making things much simpler
and easier to use.

   The special file name for network access is made up of several
fields, all of which are mandatory:

     /inet/PROTOCOL/LOCALPORT/HOSTNAME/REMOTEPORT

The `/inet/' field is, of course, constant when accessing the network.
The LOCALPORT and REMOTEPORT fields do not have a meaning when used
with `/inet/raw' because "ports" only apply to TCP and UDP. So, when
using `/inet/raw', the port fields always have to be `0'.

* Menu:

* Special File Fields::         The fields in the special file name.
* Comparing Protocols::         Differences between the protocols.


File: gawkinet.info,  Node: Special File Fields,  Next: Comparing Protocols,  Prev: Gawk Special Files,  Up: Gawk Special Files

2.1.1 The Fields of the Special File Name
-----------------------------------------

This node explains the meaning of all the other fields, as well as the
range of values and the defaults.  All of the fields are mandatory.  To
let the system pick a value, or if the field doesn't apply to the
protocol, specify it as `0':

PROTOCOL
     Determines which member of the TCP/IP family of protocols is
     selected to transport the data across the network. There are three
     possible values (always written in lowercase): `tcp', `udp', and
     `raw'. The exact meaning of each is explained later in this node.

LOCALPORT
     Determines which port on the local machine is used to communicate
     across the network. It has no meaning with `/inet/raw' and must
     therefore be `0'.  Application-level clients usually use `0' to
     indicate they do not care which local port is used--instead they
     specify a remote port to connect to. It is vital for
     application-level servers to use a number different from `0' here
     because their service has to be available at a specific publicly
     known port number. It is possible to use a name from
     `/etc/services' here.

HOSTNAME
     Determines which remote host is to be at the other end of the
     connection. Application-level servers must fill this field with a
     `0' to indicate their being open for all other hosts to connect to
     them and enforce connection level server behavior this way.  It is
     not possible for an application-level server to restrict its
     availability to one remote host by entering a host name here.
     Application-level clients must enter a name different from `0'.
     The name can be either symbolic (e.g., `jpl-devvax.jpl.nasa.gov')
     or numeric (e.g., `128.149.1.143').

REMOTEPORT
     Determines which port on the remote machine is used to communicate
     across the network. It has no meaning with `/inet/raw' and must
     therefore be 0.  For `/inet/tcp' and `/inet/udp',
     application-level clients _must_ use a number other than `0' to
     indicate to which port on the remote machine they want to connect.
     Application-level servers must not fill this field with a `0'.
     Instead they specify a local port to which clients connect.  It is
     possible to use a name from `/etc/services' here.

Experts in network programming will notice that the usual client/server
asymmetry found at the level of the socket API is not visible here.
This is for the sake of simplicity of the high-level concept. If this
asymmetry is necessary for your application, use another language.  For
`gawk', it is more important to enable users to write a client program
with a minimum of code. What happens when first accessing a network
connection is seen in the following pseudocode:

     if ((name of remote host given) && (other side accepts connection)) {
       rendez-vous successful; transmit with getline or print
     } else {
       if ((other side did not accept) && (localport == 0))
         exit unsuccessful
       if (TCP) {
         set up a server accepting connections
         this means waiting for the client on the other side to connect
       } else
         ready
     }

The exact behavior of this algorithm depends on the values of the
fields of the special file name. When in doubt, *Note
table-inet-components:: gives you the combinations of values and their
meaning. If this table is too complicated, focus on the three lines
printed in *bold*. All the examples in *Note Networking With `gawk':
Using Networking, use only the patterns printed in bold letters.

PROTOCOL    LOCAL PORT  HOST NAME   REMOTE      RESULTING CONNECTION-LEVEL
                                    PORT        BEHAVIOR
------------------------------------------------------------------------------
*tcp*       *0*         *x*         *x*          *Dedicated client, fails if
                                                immediately connecting to a
                                                            server on the
                                                other side fails*
------------------------------------------------------------------------------
udp         0           x           x           Dedicated client
------------------------------------------------------------------------------
raw         0           x           0           Dedicated client, works only
                                                as `root'
------------------------------------------------------------------------------
*tcp, udp*  *x*         *x*         *x*          *Client, switches to
                                                dedicated server if
                                                necessary*
------------------------------------------------------------------------------
*tcp, udp*  *x*         *0*         *0*          *Dedicated server*
------------------------------------------------------------------------------
raw         0           0           0           Dedicated server, works only
                                                as `root'
------------------------------------------------------------------------------
tcp, udp,   x           x           0           Invalid
raw
------------------------------------------------------------------------------
tcp, udp,   0           0           x           Invalid
raw
------------------------------------------------------------------------------
tcp, udp,   x           0           x           Invalid
raw
------------------------------------------------------------------------------
tcp, udp    0           0           0           Invalid
------------------------------------------------------------------------------
tcp, udp    0           x           0           Invalid
------------------------------------------------------------------------------
raw         x           0           0           Invalid
------------------------------------------------------------------------------
raw         0           x           x           Invalid
------------------------------------------------------------------------------
raw         x           x           x           Invalid
------------------------------------------------------------------------------

Table 2.1: /inet Special File Components

   In general, TCP is the preferred mechanism to use.  It is the
simplest protocol to understand and to use.  Use the others only if
circumstances demand low-overhead.


File: gawkinet.info,  Node: Comparing Protocols,  Prev: Special File Fields,  Up: Gawk Special Files

2.1.2 Comparing Protocols
-------------------------

This node develops a pair of programs (sender and receiver) that do
nothing but send a timestamp from one machine to another. The sender
and the receiver are implemented with each of the three protocols
available and demonstrate the differences between them.

* Menu:

* File /inet/tcp::              The TCP special file.
* File /inet/udp::              The UDP special file.
* File /inet/raw::              The RAW special file.


File: gawkinet.info,  Node: File /inet/tcp,  Next: File /inet/udp,  Prev: Comparing Protocols,  Up: Comparing Protocols

2.1.2.1 `/inet/tcp'
...................

Once again, always use TCP.  (Use UDP when low overhead is a necessity,
and use RAW for network experimentation.)  The first example is the
sender program:

     # Server
     BEGIN {
       print strftime() |& "/inet/tcp/8888/0/0"
       close("/inet/tcp/8888/0/0")
     }

The receiver is very simple:

     # Client
     BEGIN {
       "/inet/tcp/0/localhost/8888" |& getline
       print $0
       close("/inet/tcp/0/localhost/8888")
     }

TCP guarantees that the bytes arrive at the receiving end in exactly
the same order that they were sent. No byte is lost (except for broken
connections), doubled, or out of order. Some overhead is necessary to
accomplish this, but this is the price to pay for a reliable service.
It does matter which side starts first. The sender/server has to be
started first, and it waits for the receiver to read a line.


File: gawkinet.info,  Node: File /inet/udp,  Next: File /inet/raw,  Prev: File /inet/tcp,  Up: Comparing Protocols

2.1.2.2 `/inet/udp'
...................

The server and client programs that use UDP are almost identical to
their TCP counterparts; only the PROTOCOL has changed. As before, it
does matter which side starts first. The receiving side blocks and
waits for the sender.  In this case, the receiver/client has to be
started first:

     # Server
     BEGIN {
       print strftime() |& "/inet/udp/8888/0/0"
       close("/inet/udp/8888/0/0")
     }

The receiver is almost identical to the TCP receiver:

     # Client
     BEGIN {
       "/inet/udp/0/localhost/8888" |& getline
       print $0
       close("/inet/udp/0/localhost/8888")
     }

UDP cannot guarantee that the datagrams at the receiving end will
arrive in exactly the same order they were sent. Some datagrams could be
lost, some doubled, and some out of order. But no overhead is necessary
to accomplish this. This unreliable behavior is good enough for tasks
such as data acquisition, logging, and even stateless services like NFS.


File: gawkinet.info,  Node: File /inet/raw,  Prev: File /inet/udp,  Up: Comparing Protocols

2.1.2.3 `/inet/raw'
...................

This is an IP-level protocol. Only `root' is allowed to access this
special file. It is meant to be the basis for implementing and
experimenting with transport-level protocols.(1) In the most general
case, the sender has to supply the encapsulating header bytes in front
of the packet and the receiver has to strip the additional bytes from
the message.

RAW receivers cannot receive packets sent with TCP or UDP because the
operating system does not deliver the packets to a RAW receiver. The
operating system knows about some of the protocols on top of IP and
decides on its own which packet to deliver to which process.  (d.c.)
Therefore, the UDP receiver must be used for receiving UDP datagrams
sent with the RAW sender. This is a dark corner, not only of `gawk',
but also of TCP/IP.

For extended experimentation with protocols, look into the approach
implemented in a tool called SPAK.  This tool reflects the hierarchical
layering of protocols (encapsulation) in the way data streams are piped
out of one program into the next one.  It shows which protocol is based
on which other (lower-level) protocol by looking at the command-line
ordering of the program calls.  Cleverly thought out, SPAK is much
better than `gawk''s `/inet' for learning the meaning of each and every
bit in the protocol headers.

The next example uses the RAW protocol to emulate the behavior of UDP.
The sender program is the same as above, but with some additional bytes
that fill the places of the UDP fields:

     BEGIN {
       Message = "Hello world\n"
       SourcePort = 0
       DestinationPort = 8888
       MessageLength = length(Message)+8
       RawService = "/inet/raw/0/localhost/0"
       printf("%c%c%c%c%c%c%c%c%s",
           SourcePort/256, SourcePort%256,
           DestinationPort/256, DestinationPort%256,
           MessageLength/256, MessageLength%256,
           0, 0, Message) |& RawService
       fflush(RawService)
       close(RawService)
     }

Since this program tries to emulate the behavior of UDP, it checks if
the RAW sender is understood by the UDP receiver but not if the RAW
receiver can understand the UDP sender. In a real network, the RAW
receiver is hardly of any use because it gets every IP packet that
comes across the network. There are usually so many packets that `gawk'
would be too slow for processing them.  Only on a network with little
traffic can the IP-level receiver program be tested. Programs for
analyzing IP traffic on modem or ISDN channels should be possible.

Port numbers do not have a meaning when using `/inet/raw'. Their fields
have to be `0'. Only TCP and UDP use ports. Receiving data from
`/inet/raw' is difficult, not only because of processing speed but also
because data is usually binary and not restricted to ASCII. This
implies that line separation with `RS' does not work as usual.

---------- Footnotes ----------

(1) This special file is reserved, but not otherwise currently
implemented.


File: gawkinet.info,  Node: TCP Connecting,  Next: Troubleshooting,  Prev: Gawk Special Files,  Up: Using Networking

2.2 Establishing a TCP Connection
=================================

Let's observe a network connection at work. Type in the following
program and watch the output. Within a second, it connects via TCP
(`/inet/tcp') to the machine it is running on (`localhost') and asks
the service `daytime' on the machine what time it is:

     BEGIN {
       "/inet/tcp/0/localhost/daytime" |& getline
       print $0
       close("/inet/tcp/0/localhost/daytime")
     }

Even experienced `awk' users will find the second line strange in two
respects:

   * A special file is used as a shell command that pipes its output
     into `getline'. One would rather expect to see the special file
     being read like any other file (`getline <
     "/inet/tcp/0/localhost/daytime")'.

   * The operator `|&' has not been part of any `awk' implementation
     (until now).  It is actually the only extension of the `awk'
     language needed (apart from the special files) to introduce
     network access.

The `|&' operator was introduced in `gawk' 3.1 in order to overcome the
crucial restriction that access to files and pipes in `awk' is always
unidirectional. It was formerly impossible to use both access modes on
the same file or pipe. Instead of changing the whole concept of file
access, the `|&' operator behaves exactly like the usual pipe operator
except for two additions:

   * Normal shell commands connected to their `gawk' program with a `|&'
     pipe can be accessed bidirectionally. The `|&' turns out to be a
     quite general, useful, and natural extension of `awk'.

   * Pipes that consist of a special file name for network connections
     are not executed as shell commands. Instead, they can be read and
     written to, just like a full-duplex network connection.

In the earlier example, the `|&' operator tells `getline' to read a
line from the special file `/inet/tcp/0/localhost/daytime'.  We could
also have printed a line into the special file. But instead we just
read a line with the time, printed it, and closed the connection.
(While we could just let `gawk' close the connection by finishing the
program, in this Info file we are pedantic and always explicitly close
the connections.)


File: gawkinet.info,  Node: Troubleshooting,  Next: Interacting,  Prev: TCP Connecting,  Up: Using Networking

2.3 Troubleshooting Connection Problems
=======================================

It may well be that for some reason the program shown in the previous
example does not run on your machine. When looking at possible reasons
for this, you will learn much about typical problems that arise in
network programming. First of all, your implementation of `gawk' may
not support network access because it is a pre-3.1 version or you do
not have a network interface in your machine.  Perhaps your machine
uses some other protocol, such as DECnet or Novell's IPX. For the rest
of this major node, we will assume you work on a Unix machine that
supports TCP/IP. If the previous example program does not run on your
machine, it may help to replace the name `localhost' with the name of
your machine or its IP address. If it does, you could replace
`localhost' with the name of another machine in your vicinity--this
way, the program connects to another machine.  Now you should see the
date and time being printed by the program, otherwise your machine may
not support the `daytime' service.  Try changing the service to
`chargen' or `ftp'. This way, the program connects to other services
that should give you some response. If you are curious, you should have
a look at your `/etc/services' file. It could look like this:

     # /etc/services:
     #
     # Network services, Internet style
     #
     # Name     Number/Protcol  Alternate name # Comments

     echo        7/tcp
     echo        7/udp
     discard     9/tcp         sink null
     discard     9/udp         sink null
     daytime     13/tcp
     daytime     13/udp
     chargen     19/tcp        ttytst source
     chargen     19/udp        ttytst source
     ftp         21/tcp
     telnet      23/tcp
     smtp        25/tcp        mail
     finger      79/tcp
     www         80/tcp        http      # WorldWideWeb HTTP
     www         80/udp        # HyperText Transfer Protocol
     pop-2       109/tcp       postoffice    # POP version 2
     pop-2       109/udp
     pop-3       110/tcp       # POP version 3
     pop-3       110/udp
     nntp        119/tcp       readnews untp  # USENET News
     irc         194/tcp       # Internet Relay Chat
     irc         194/udp
     ...

Here, you find a list of services that traditional Unix machines usually
support. If your GNU/Linux machine does not do so, it may be that these
services are switched off in some startup script. Systems running some
flavor of Microsoft Windows usually do _not_ support these services.
Nevertheless, it _is_ possible to do networking with `gawk' on Microsoft
Windows.(1) The first column of the file gives the name of the service,
and the second column gives a unique number and the protocol that one
can use to connect to this service.  The rest of the line is treated as
a comment.  You see that some services (`echo') support TCP as well as
UDP.

---------- Footnotes ----------

(1) Microsoft prefered to ignore the TCP/IP family of protocols until
1995. Then came the rise of the Netscape browser as a landmark "killer
application." Microsoft added TCP/IP support and their own browser to
Microsoft Windows 95 at the last minute. They even back-ported their
TCP/IP implementation to Microsoft Windows for Workgroups 3.11, but it
was a rather rudimentary and half-hearted implementation. Nevertheless,
the equivalent of `/etc/services' resides under
`C:\WINNT\system32\drivers\etc\services' on Microsoft Windows 2000.


File: gawkinet.info,  Node: Interacting,  Next: Setting Up,  Prev: Troubleshooting,  Up: Using Networking

2.4 Interacting with a Network Service
======================================

The next program makes use of the possibility to really interact with a
network service by printing something into the special file. It asks the
so-called `finger' service if a user of the machine is logged in. When
testing this program, try to change `localhost' to some other machine
name in your local network:

     BEGIN {
       NetService = "/inet/tcp/0/localhost/finger"
       print "NAME" |& NetService
       while ((NetService |& getline) > 0)
         print $0
       close(NetService)
     }

After telling the service on the machine which user to look for, the
program repeatedly reads lines that come as a reply. When no more lines
are coming (because the service has closed the connection), the program
also closes the connection. Try replacing `"NAME"' with your login name
(or the name of someone else logged in).  For a list of all users
currently logged in, replace NAME with an empty string (`""').

The final `close' command could be safely deleted from the above
script, because the operating system closes any open connection by
default when a script reaches the end of execution. In order to avoid
portability problems, it is best to always close connections explicitly.
With the Linux kernel, for example, proper closing results in flushing
of buffers. Letting the close happen by default may result in
discarding buffers.

When looking at `/etc/services' you may have noticed that the `daytime'
service is also available with `udp'. In the earlier example, change
`tcp' to `udp', and change `finger' to `daytime'.  After starting the
modified program, you see the expected day and time message.  The
program then hangs, because it waits for more lines coming from the
service. However, they never come. This behavior is a consequence of the
differences between TCP and UDP. When using UDP, neither party is
automatically informed about the other closing the connection.
Continuing to experiment this way reveals many other subtle differences
between TCP and UDP. To avoid such trouble, one should always remember
the advice Douglas E. Comer and David Stevens give in Volume III of
their series `Internetworking With TCP' (page 14):

     When designing client-server applications, beginners are strongly
     advised to use TCP because it provides reliable,
     connection-oriented communication. Programs only use UDP if the
     application protocol handles reliability, the application requires
     hardware broadcast or multicast, or the application cannot
     tolerate virtual circuit overhead.


File: gawkinet.info,  Node: Setting Up,  Next: Email,  Prev: Interacting,  Up: Using Networking

2.5 Setting Up a Service
========================

The preceding programs behaved as clients that connect to a server
somewhere on the Internet and request a particular service. Now we set
up such a service to mimic the behavior of the `daytime' service.  Such
a server does not know in advance who is going to connect to it over
the network. Therefore, we cannot insert a name for the host to connect
to in our special file name.

Start the following program in one window. Notice that the service does
not have the name `daytime', but the number `8888'.  From looking at
`/etc/services', you know that names like `daytime' are just mnemonics
for predetermined 16-bit integers.  Only the system administrator
(`root') could enter our new service into `/etc/services' with an
appropriate name.  Also notice that the service name has to be entered
into a different field of the special file name because we are setting
up a server, not a client:

     BEGIN {
       print strftime() |& "/inet/tcp/8888/0/0"
       close("/inet/tcp/8888/0/0")
     }

Now open another window on the same machine.  Copy the client program
given as the first example (*note Establishing a TCP Connection: TCP
Connecting.)  to a new file and edit it, changing the name `daytime' to
`8888'.  Then start the modified client.  You should get a reply like
this:

     Sat Sep 27 19:08:16 CEST 1997

Both programs explicitly close the connection.

Now we will intentionally make a mistake to see what happens when the
name `8888' (the so-called port) is already used by another service.
Start the server program in both windows. The first one works, but the
second one complains that it could not open the connection. Each port
on a single machine can only be used by one server program at a time.
Now terminate the server program and change the name `8888' to `echo'.
After restarting it, the server program does not run any more, and you
know why: there is already an `echo' service running on your machine.
But even if this isn't true, you would not get your own `echo' server
running on a Unix machine, because the ports with numbers smaller than
1024 (`echo' is at port 7) are reserved for `root'.  On machines
running some flavor of Microsoft Windows, there is no restriction that
reserves ports 1 to 1024 for a privileged user; hence, you can start an
`echo' server there.

Turning this short server program into something really useful is
simple.  Imagine a server that first reads a file name from the client
through the network connection, then does something with the file and
sends a result back to the client. The server-side processing could be:

     BEGIN {
       NetService = "/inet/tcp/8888/0/0"
       NetService |& getline
       CatPipe    = ("cat " $1)    # sets $0 and the fields
       while ((CatPipe | getline) > 0)
         print $0 |& NetService
       close(NetService)
     }

and we would have a remote copying facility. Such a server reads the
name of a file from any client that connects to it and transmits the
contents of the named file across the net. The server-side processing
could also be the execution of a command that is transmitted across the
network. From this example, you can see how simple it is to open up a
security hole on your machine. If you allow clients to connect to your
machine and execute arbitrary commands, anyone would be free to do `rm
-rf *'.


File: gawkinet.info,  Node: Email,  Next: Web page,  Prev: Setting Up,  Up: Using Networking

2.6 Reading Email
=================

The distribution of email is usually done by dedicated email servers
that communicate with your machine using special protocols. To receive
email, we will use the Post Office Protocol (POP).  Sending can be done
with the much older Simple Mail Transfer Protocol (SMTP).

When you type in the following program, replace the EMAILHOST by the
name of your local email server. Ask your administrator if the server
has a POP service, and then use its name or number in the program below.
Now the program is ready to connect to your email server, but it will
not succeed in retrieving your mail because it does not yet know your
login name or password. Replace them in the program and it shows you
the first email the server has in store:

     BEGIN {
       POPService  = "/inet/tcp/0/EMAILHOST/pop3"
       RS = ORS = "\r\n"
       print "user NAME"            |& POPService
       POPService                    |& getline
       print "pass PASSWORD"         |& POPService
       POPService                    |& getline
       print "retr 1"                |& POPService
       POPService                    |& getline
       if ($1 != "+OK") exit
       print "quit"                  |& POPService
       RS = "\r\n\\.\r\n"
       POPService |& getline
       print $0
       close(POPService)
     }

The record separators `RS' and `ORS' are redefined because the protocol
(POP) requires CR-LF to separate lines. After identifying yourself to
the email service, the command `retr 1' instructs the service to send
the first of all your email messages in line. If the service replies
with something other than `+OK', the program exits; maybe there is no
email. Otherwise, the program first announces that it intends to finish
reading email, and then redefines `RS' in order to read the entire
email as multiline input in one record. From the POP RFC, we know that
the body of the email always ends with a single line containing a
single dot.  The program looks for this using `RS = "\r\n\\.\r\n"'.
When it finds this sequence in the mail message, it quits.  You can
invoke this program as often as you like; it does not delete the
message it reads, but instead leaves it on the server.


File: gawkinet.info,  Node: Web page,  Next: Primitive Service,  Prev: Email,  Up: Using Networking

2.7 Reading a Web Page
======================

Retrieving a web page from a web server is as simple as retrieving
email from an email server. We only have to use a similar, but not
identical, protocol and a different port. The name of the protocol is
HyperText Transfer Protocol (HTTP) and the port number is usually 80.
As in the preceding node, ask your administrator about the name of your
local web server or proxy web server and its port number for HTTP
requests.

The following program employs a rather crude approach toward retrieving
a web page. It uses the prehistoric syntax of HTTP 0.9, which almost all
web servers still support. The most noticeable thing about it is that
the program directs the request to the local proxy server whose name
you insert in the special file name (which in turn calls
`www.yahoo.com'):

     BEGIN {
       RS = ORS = "\r\n"
       HttpService = "/inet/tcp/0/PROXY/80"
       print "GET http://www.yahoo.com"     |& HttpService
       while ((HttpService |& getline) > 0)
          print $0
       close(HttpService)
     }

Again, lines are separated by a redefined `RS' and `ORS'.  The `GET'
request that we send to the server is the only kind of HTTP request
that existed when the web was created in the early 1990s.  HTTP calls
this `GET' request a "method," which tells the service to transmit a
web page (here the home page of the Yahoo! search engine). Version 1.0
added the request methods `HEAD' and `POST'. The current version of
HTTP is 1.1,(1) and knows the additional request methods `OPTIONS',
`PUT', `DELETE', and `TRACE'.  You can fill in any valid web address,
and the program prints the HTML code of that page to your screen.

Notice the similarity between the responses of the POP and HTTP
services. First, you get a header that is terminated by an empty line,
and then you get the body of the page in HTML.  The lines of the
headers also have the same form as in POP. There is the name of a
parameter, then a colon, and finally the value of that parameter.

Images (`.png' or `.gif' files) can also be retrieved this way, but
then you get binary data that should be redirected into a file. Another
application is calling a CGI (Common Gateway Interface) script on some
server. CGI scripts are used when the contents of a web page are not
constant, but generated instantly at the moment you send a request for
the page. For example, to get a detailed report about the current
quotes of Motorola stock shares, call a CGI script at Yahoo! with the
following:

     get = "GET http://quote.yahoo.com/q?s=MOT&d=t"
     print get |& HttpService

You can also request weather reports this way.

---------- Footnotes ----------

(1) Version 1.0 of HTTP was defined in RFC 1945.  HTTP 1.1 was
initially specified in RFC 2068. In June 1999, RFC 2068 was made
obsolete by RFC 2616, an update without any substantial changes.


File: gawkinet.info,  Node: Primitive Service,  Next: Interacting Service,  Prev: Web page,  Up: Using Networking

2.8 A Primitive Web Service
===========================

Now we know enough about HTTP to set up a primitive web service that
just says `"Hello, world"' when someone connects to it with a browser.
Compared to the situation in the preceding node, our program changes
the role. It tries to behave just like the server we have observed.
Since we are setting up a server here, we have to insert the port
number in the `localport' field of the special file name. The other two
fields (HOSTNAME and REMOTEPORT) have to contain a `0' because we do
not know in advance which host will connect to our service.

In the early 1990s, all a server had to do was send an HTML document and
close the connection. Here, we adhere to the modern syntax of HTTP.
The steps are as follows:

  1. Send a status line telling the web browser that everything is okay.

  2. Send a line to tell the browser how many bytes follow in the body
     of the message. This was not necessary earlier because both
     parties knew that the document ended when the connection closed.
     Nowadays it is possible to stay connected after the transmission
     of one web page.  This is to avoid the network traffic necessary
     for repeatedly establishing TCP connections for requesting several
     images. Thus, there is the need to tell the receiving party how
     many bytes will be sent. The header is terminated as usual with an
     empty line.

  3. Send the `"Hello, world"' body in HTML.  The useless `while' loop
     swallows the request of the browser.  We could actually omit the
     loop, and on most machines the program would still work.  First,
     start the following program:

     BEGIN {
       RS = ORS = "\r\n"
       HttpService = "/inet/tcp/8080/0/0"
       Hello = "<HTML><HEAD>" \
               "<TITLE>A Famous Greeting</TITLE></HEAD>" \
               "<BODY><H1>Hello, world</H1></BODY></HTML>"
       Len = length(Hello) + length(ORS)
       print "HTTP/1.0 200 OK"          |& HttpService
       print "Content-Length: " Len ORS |& HttpService
       print Hello                      |& HttpService
       while ((HttpService |& getline) > 0)
          continue;
       close(HttpService)
     }

Now, on the same machine, start your favorite browser and let it point
to `http://localhost:8080' (the browser needs to know on which port our
server is listening for requests). If this does not work, the browser
probably tries to connect to a proxy server that does not know your
machine.  If so, change the browser's configuration so that the browser
does not try to use a proxy to connect to your machine.


File: gawkinet.info,  Node: Interacting Service,  Next: Simple Server,  Prev: Primitive Service,  Up: Using Networking

2.9 A Web Service with Interaction
==================================

This node shows how to set up a simple web server.  The subnode is a
library file that we will use with all the examples in *Note Some
Applications and Techniques::.

* Menu:

* CGI Lib::                     A simple CGI library.

Setting up a web service that allows user interaction is more difficult
and shows us the limits of network access in `gawk'. In this node, we
develop  a main program (a `BEGIN' pattern and its action) that will
become the core of event-driven execution controlled by a graphical
user interface (GUI).  Each HTTP event that the user triggers by some
action within the browser is received in this central procedure.
Parameters and menu choices are extracted from this request, and an
appropriate measure is taken according to the user's choice.  For
example:

     BEGIN {
       if (MyHost == "") {
          "uname -n" | getline MyHost
          close("uname -n")
       }
       if (MyPort ==  0) MyPort = 8080
       HttpService = "/inet/tcp/" MyPort "/0/0"
       MyPrefix    = "http://" MyHost ":" MyPort
       SetUpServer()
       while ("awk" != "complex") {
         # header lines are terminated this way
         RS = ORS = "\r\n"
         Status   = 200          # this means OK
         Reason   = "OK"
         Header   = TopHeader
         Document = TopDoc
         Footer   = TopFooter
         if        (GETARG["Method"] == "GET") {
             HandleGET()
         } else if (GETARG["Method"] == "HEAD") {
             # not yet implemented
         } else if (GETARG["Method"] != "") {
             print "bad method", GETARG["Method"]
         }
         Prompt = Header Document Footer
         print "HTTP/1.0", Status, Reason       |& HttpService
         print "Connection: Close"              |& HttpService
         print "Pragma: no-cache"               |& HttpService
         len = length(Prompt) + length(ORS)
         print "Content-length:", len           |& HttpService
         print ORS Prompt                       |& HttpService
         # ignore all the header lines
         while ((HttpService |& getline) > 0)
             ;
         # stop talking to this client
         close(HttpService)
         # wait for new client request
         HttpService |& getline
         # do some logging
         print systime(), strftime(), $0
         # read request parameters
         CGI_setup($1, $2, $3)
       }
     }

This web server presents menu choices in the form of HTML links.
Therefore, it has to tell the browser the name of the host it is
residing on. When starting the server, the user may supply the name of
the host from the command line with `gawk -v MyHost="Rumpelstilzchen"'.
If the user does not do this, the server looks up the name of the host
it is running on for later use as a web address in HTML documents. The
same applies to the port number. These values are inserted later into
the HTML content of the web pages to refer to the home system.

Each server that is built around this core has to initialize some
application-dependent variables (such as the default home page) in a
procedure `SetUpServer', which is called immediately before entering the
infinite loop of the server. For now, we will write an instance that
initiates a trivial interaction.  With this home page, the client user
can click on two possible choices, and receive the current date either
in human-readable format or in seconds since 1970:

     function SetUpServer() {
       TopHeader = "<HTML><HEAD>"
       TopHeader = TopHeader \
          "<title>My name is GAWK, GNU AWK</title></HEAD>"
       TopDoc    = "<BODY><h2>\
         Do you prefer your date <A HREF=" MyPrefix \
         "/human>human</A> or \
         <A HREF=" MyPrefix "/POSIX>POSIXed</A>?</h2>" ORS ORS
       TopFooter = "</BODY></HTML>"
     }

On the first run through the main loop, the default line terminators are
set and the default home page is copied to the actual home page. Since
this is the first run, `GETARG["Method"]' is not initialized yet, hence
the case selection over the method does nothing. Now that the home page
is initialized, the server can start communicating to a client browser.

It does so by printing the HTTP header into the network connection
(`print ... |& HttpService'). This command blocks execution of the
server script until a client connects. If this server script is
compared with the primitive one we wrote before, you will notice two
additional lines in the header. The first instructs the browser to
close the connection after each request. The second tells the browser
that it should never try to _remember_ earlier requests that had
identical web addresses (no caching). Otherwise, it could happen that
the browser retrieves the time of day in the previous example just once,
and later it takes the web page from the cache, always displaying the
same time of day although time advances each second.

Having supplied the initial home page to the browser with a valid
document stored in the parameter `Prompt', it closes the connection and
waits for the next request.  When the request comes, a log line is
printed that allows us to see which request the server receives. The
final step in the loop is to call the function `CGI_setup', which reads
all the lines of the request (coming from the browser), processes them,
and stores the transmitted parameters in the array `PARAM'. The complete
text of these application-independent functions can be found in *Note A
Simple CGI Library: CGI Lib.  For now, we use a simplified version of
`CGI_setup':

     function CGI_setup(   method, uri, version, i) {
       delete GETARG;         delete MENU;        delete PARAM
       GETARG["Method"] = $1
       GETARG["URI"] = $2
       GETARG["Version"] = $3
       i = index($2, "?")
       # is there a "?" indicating a CGI request?
       if (i > 0) {
         split(substr($2, 1, i-1), MENU, "[/:]")
         split(substr($2, i+1), PARAM, "&")
         for (i in PARAM) {
           j = index(PARAM[i], "=")
           GETARG[substr(PARAM[i], 1, j-1)] = \
                                       substr(PARAM[i], j+1)
         }
       } else {    # there is no "?", no need for splitting PARAMs
         split($2, MENU, "[/:]")
       }
     }

At first, the function clears all variables used for global storage of
request parameters. The rest of the function serves the purpose of
filling the global parameters with the extracted new values.  To
accomplish this, the name of the requested resource is split into parts
and stored for later evaluation. If the request contains a `?', then
the request has CGI variables seamlessly appended to the web address.
Everything in front of the `?' is split up into menu items, and
everything behind the `?' is a list of `VARIABLE=VALUE' pairs
(separated by `&') that also need splitting. This way, CGI variables are
isolated and stored. This procedure lacks recognition of special
characters that are transmitted in coded form(1). Here, any optional
request header and body parts are ignored. We do not need header
parameters and the request body. However, when refining our approach or
working with the `POST' and `PUT' methods, reading the header and body
becomes inevitable. Header parameters should then be stored in a global
array as well as the body.

On each subsequent run through the main loop, one request from a
browser is received, evaluated, and answered according to the user's
choice. This can be done by letting the value of the HTTP method guide
the main loop into execution of the procedure `HandleGET', which
evaluates the user's choice. In this case, we have only one
hierarchical level of menus, but in the general case, menus are nested.
The menu choices at each level are separated by `/', just as in file
names. Notice how simple it is to construct menus of arbitrary depth:

     function HandleGET() {
       if (       MENU[2] == "human") {
         Footer = strftime() TopFooter
       } else if (MENU[2] == "POSIX") {
         Footer = systime()  TopFooter
       }
     }

The disadvantage of this approach is that our server is slow and can
handle only one request at a time. Its main advantage, however, is that
the server consists of just one `gawk' program. No need for installing
an `httpd', and no need for static separate HTML files, CGI scripts, or
`root' privileges. This is rapid prototyping.  This program can be
started on the same host that runs your browser.  Then let your browser
point to `http://localhost:8080'.

It is also possible to include images into the HTML pages.  Most
browsers support the not very well-known `.xbm' format, which may
contain only monochrome pictures but is an ASCII format. Binary images
are possible but not so easy to handle. Another way of including images
is to generate them with a tool such as GNUPlot, by calling the tool
with the `system' function or through a pipe.

---------- Footnotes ----------

(1) As defined in RFC 2068.


File: gawkinet.info,  Node: CGI Lib,  Prev: Interacting Service,  Up: Interacting Service

2.9.1 A Simple CGI Library
--------------------------

     HTTP is like being married: you have to be able to handle whatever
     you're given, while being very careful what you send back.
     Phil Smith III,
     `http://www.netfunny.com/rhf/jokes/99/Mar/http.html'

In *Note A Web Service with Interaction: Interacting Service, we saw
the function `CGI_setup' as part of the web server "core logic"
framework. The code presented there handles almost everything necessary
for CGI requests.  One thing it doesn't do is handle encoded characters
in the requests.  For example, an `&' is encoded as a percent sign
followed by the hexadecimal value: `%26'.  These encoded values should
be decoded.  Following is a simple library to perform these tasks.
This code is used for all web server examples used throughout the rest
of this Info file.  If you want to use it for your own web server,
store the source code into a file named `inetlib.awk'. Then you can
include these functions into your code by placing the following
statement into your program (on the first line of your script):

     @include inetlib.awk

But beware, this mechanism is only possible if you invoke your web
server script with `igawk' instead of the usual `awk' or `gawk'.  Here
is the code:

     # CGI Library and core of a web server
     # Global arrays
     #   GETARG --- arguments to CGI GET command
     #   MENU   --- menu items (path names)
     #   PARAM  --- parameters of form x=y

     # Optional variable MyHost contains host address
     # Optional variable MyPort contains port number
     # Needs TopHeader, TopDoc, TopFooter
     # Sets MyPrefix, HttpService, Status, Reason

     BEGIN {
       if (MyHost == "") {
          "uname -n" | getline MyHost
          close("uname -n")
       }
       if (MyPort ==  0) MyPort = 8080
       HttpService = "/inet/tcp/" MyPort "/0/0"
       MyPrefix    = "http://" MyHost ":" MyPort
       SetUpServer()
       while ("awk" != "complex") {
         # header lines are terminated this way
         RS = ORS    = "\r\n"
         Status      = 200             # this means OK
         Reason      = "OK"
         Header      = TopHeader
         Document    = TopDoc
         Footer      = TopFooter
         if        (GETARG["Method"] == "GET") {
             HandleGET()
         } else if (GETARG["Method"] == "HEAD") {
             # not yet implemented
         } else if (GETARG["Method"] != "") {
             print "bad method", GETARG["Method"]
         }
         Prompt = Header Document Footer
         print "HTTP/1.0", Status, Reason     |& HttpService
         print "Connection: Close"            |& HttpService
         print "Pragma: no-cache"             |& HttpService
         len = length(Prompt) + length(ORS)
         print "Content-length:", len         |& HttpService
         print ORS Prompt                     |& HttpService
         # ignore all the header lines
         while ((HttpService |& getline) > 0)
             continue
         # stop talking to this client
         close(HttpService)
         # wait for new client request
         HttpService |& getline
         # do some logging
         print systime(), strftime(), $0
         CGI_setup($1, $2, $3)
       }
     }

     function CGI_setup(   method, uri, version, i)
     {
         delete GETARG
         delete MENU
         delete PARAM
         GETARG["Method"] = method
         GETARG["URI"] = uri
         GETARG["Version"] = version

         i = index(uri, "?")
         if (i > 0) {  # is there a "?" indicating a CGI request?
             split(substr(uri, 1, i-1), MENU, "[/:]")
             split(substr(uri, i+1), PARAM, "&")
             for (i in PARAM) {
                 PARAM[i] = _CGI_decode(PARAM[i])
                 j = index(PARAM[i], "=")
                 GETARG[substr(PARAM[i], 1, j-1)] = \
                                              substr(PARAM[i], j+1)
             }
         } else { # there is no "?", no need for splitting PARAMs
             split(uri, MENU, "[/:]")
         }
         for (i in MENU)     # decode characters in path
             if (i > 4)      # but not those in host name
                 MENU[i] = _CGI_decode(MENU[i])
     }

This isolates details in a single function, `CGI_setup'.  Decoding of
encoded characters is pushed off to a helper function, `_CGI_decode'.
The use of the leading underscore (`_') in the function name is
intended to indicate that it is an "internal" function, although there
is nothing to enforce this:

     function _CGI_decode(str,   hexdigs, i, pre, code1, code2,
                                 val, result)
     {
        hexdigs = "123456789abcdef"

        i = index(str, "%")
        if (i == 0) # no work to do
           return str

        do {
           pre = substr(str, 1, i-1)   # part before %xx
           code1 = substr(str, i+1, 1) # first hex digit
           code2 = substr(str, i+2, 1) # second hex digit
           str = substr(str, i+3)      # rest of string

           code1 = tolower(code1)
           code2 = tolower(code2)
           val = index(hexdigs, code1) * 16 \
                 + index(hexdigs, code2)

           result = result pre sprintf("%c", val)
           i = index(str, "%")
        } while (i != 0)
        if (length(str) > 0)
           result = result str
        return result
     }

This works by splitting the string apart around an encoded character.
The two digits are converted to lowercase characters and looked up in a
string of hex digits.  Note that `0' is not in the string on purpose;
`index' returns zero when it's not found, automatically giving the
correct value!  Once the hexadecimal value is converted from characters
in a string into a numerical value, `sprintf' converts the value back
into a real character.  The following is a simple test harness for the
above functions:

     BEGIN {
       CGI_setup("GET",
       "http://www.gnu.org/cgi-bin/foo?p1=stuff&p2=stuff%26junk" \
            "&percent=a %25 sign",
       "1.0")
       for (i in MENU)
           printf "MENU[\"%s\"] = %s\n", i, MENU[i]
       for (i in PARAM)
           printf "PARAM[\"%s\"] = %s\n", i, PARAM[i]
       for (i in GETARG)
           printf "GETARG[\"%s\"] = %s\n", i, GETARG[i]
     }

And this is the result when we run it:

     $ gawk -f testserv.awk
     -| MENU["4"] = www.gnu.org
     -| MENU["5"] = cgi-bin
     -| MENU["6"] = foo
     -| MENU["1"] = http
     -| MENU["2"] =
     -| MENU["3"] =
     -| PARAM["1"] = p1=stuff
     -| PARAM["2"] = p2=stuff&junk
     -| PARAM["3"] = percent=a % sign
     -| GETARG["p1"] = stuff
     -| GETARG["percent"] = a % sign
     -| GETARG["p2"] = stuff&junk
     -| GETARG["Method"] = GET
     -| GETARG["Version"] = 1.0
     -| GETARG["URI"] = http://www.gnu.org/cgi-bin/foo?p1=stuff&
     p2=stuff%26junk&percent=a %25 sign


File: gawkinet.info,  Node: Simple Server,  Next: Caveats,  Prev: Interacting Service,  Up: Using Networking

2.10 A Simple Web Server
========================

In the preceding node, we built the core logic for event-driven GUIs.
In this node, we finally extend the core to a real application.  No one
would actually write a commercial web server in `gawk', but it is
instructive to see that it is feasible in principle.

The application is ELIZA, the famous program by Joseph Weizenbaum that
mimics the behavior of a professional psychotherapist when talking to
you.  Weizenbaum would certainly object to this description, but this
is part of the legend around ELIZA.  Take the site-independent core
logic and append the following code:

     function SetUpServer() {
       SetUpEliza()
       TopHeader = \
         "<HTML><title>An HTTP-based System with GAWK</title>\
         <HEAD><META HTTP-EQUIV=\"Content-Type\"\
         CONTENT=\"text/html; charset=iso-8859-1\"></HEAD>\
         <BODY BGCOLOR=\"#ffffff\" TEXT=\"#000000\"\
         LINK=\"#0000ff\" VLINK=\"#0000ff\"\
         ALINK=\"#0000ff\"> <A NAME=\"top\">"
       TopDoc    = "\
        <h2>Please choose one of the following actions:</h2>\
        <UL>\
        <LI>\
        <A HREF=" MyPrefix "/AboutServer>About this server</A>\
        </LI><LI>\
        <A HREF=" MyPrefix "/AboutELIZA>About Eliza</A></LI>\
        <LI>\
        <A HREF=" MyPrefix \
           "/StartELIZA>Start talking to Eliza</A></LI></UL>"
       TopFooter = "</BODY></HTML>"
     }

`SetUpServer' is similar to the previous example, except for calling
another function, `SetUpEliza'.  This approach can be used to implement
other kinds of servers.  The only changes needed to do so are hidden in
the functions `SetUpServer' and `HandleGET'. Perhaps it might be
necessary to implement other HTTP methods.  The `igawk' program that
comes with `gawk' may be useful for this process.

When extending this example to a complete application, the first thing
to do is to implement the function `SetUpServer' to initialize the HTML
pages and some variables. These initializations determine the way your
HTML pages look (colors, titles, menu items, etc.).

The function `HandleGET' is a nested case selection that decides which
page the user wants to see next.  Each nesting level refers to a menu
level of the GUI. Each case implements a certain action of the menu. On
the deepest level of case selection, the handler essentially knows what
the user wants and stores the answer into the variable that holds the
HTML page contents:

     function HandleGET() {
       # A real HTTP server would treat some parts of the URI as a file name.
       # We take parts of the URI as menu choices and go on accordingly.
       if(MENU[2] == "AboutServer") {
         Document    = "This is not a CGI script.\
           This is an httpd, an HTML file, and a CGI script all \
           in one GAWK script. It needs no separate www-server, \
           no installation, and no root privileges.\
           <p>To run it, do this:</p><ul>\
           <li> start this script with \"gawk -f httpserver.awk\",</li>\
           <li> and on the same host let your www browser open location\
                \"http://localhost:8080\"</li>\
           </ul>\<p>\ Details of HTTP come from:</p><ul>\
                 <li>Hethmon:  Illustrated Guide to HTTP</p>\
                 <li>RFC 2068</li></ul><p>JK 14.9.1997</p>"
       } else if (MENU[2] == "AboutELIZA") {
         Document    = "This is an implementation of the famous ELIZA\
             program by Joseph Weizenbaum. It is written in GAWK and\
     /bin/sh: expad: command not found
       } else if (MENU[2] == "StartELIZA") {
         gsub(/\+/, " ", GETARG["YouSay"])
         # Here we also have to substitute coded special characters
         Document    = "<form method=GET>" \
           "<h3>" ElizaSays(GETARG["YouSay"]) "</h3>\
           <p><input type=text name=YouSay value=\"\" size=60>\
           <br><input type=submit value=\"Tell her about it\"></p></form>"
       }
     }

Now we are down to the heart of ELIZA, so you can see how it works.
Initially the user does not say anything; then ELIZA resets its money
counter and asks the user to tell what comes to mind open heartedly.
The subsequent answers are converted to uppercase characters and stored
for later comparison. ELIZA presents the bill when being confronted with
a sentence that contains the phrase "shut up." Otherwise, it looks for
keywords in the sentence, conjugates the rest of the sentence, remembers
the keyword for later use, and finally selects an answer from the set of
possible answers:

     function ElizaSays(YouSay) {
       if (YouSay == "") {
         cost = 0
         answer = "HI, IM ELIZA, TELL ME YOUR PROBLEM"
       } else {
         q = toupper(YouSay)
         gsub("'", "", q)
         if(q == qold) {
           answer = "PLEASE DONT REPEAT YOURSELF !"
         } else {
           if (index(q, "SHUT UP") > 0) {
             answer = "WELL, PLEASE PAY YOUR BILL. ITS EXACTLY ... $"\
                      int(100*rand()+30+cost/100)
           } else {
             qold = q
             w = "-"                 # no keyword recognized yet
             for (i in k) {          # search for keywords
               if (index(q, i) > 0) {
                 w = i
                 break
               }
             }
             if (w == "-") {         # no keyword, take old subject
               w    = wold
               subj = subjold
             } else {                # find subject
               subj = substr(q, index(q, w) + length(w)+1)
               wold = w
               subjold = subj        #  remember keyword and subject
             }
             for (i in conj)
                gsub(i, conj[i], q)   # conjugation
             # from all answers to this keyword, select one randomly
             answer = r[indices[int(split(k[w], indices) * rand()) + 1]]
             # insert subject into answer
             gsub("_", subj, answer)
           }
         }
       }
       cost += length(answer) # for later payment : 1 cent per character
       return answer
     }

In the long but simple function `SetUpEliza', you can see tables for
conjugation, keywords, and answers.(1) The associative array `k'
contains indices into the array of answers `r'. To choose an answer,
ELIZA just picks an index randomly:

     function SetUpEliza() {
       srand()
       wold = "-"
       subjold = " "

       # table for conjugation
       conj[" ARE "     ] = " AM "
       conj["WERE "     ] = "WAS "
       conj[" YOU "     ] = " I "
       conj["YOUR "     ] = "MY "
       conj[" IVE "     ] =\
       conj[" I HAVE "  ] = " YOU HAVE "
       conj[" YOUVE "   ] =\
       conj[" YOU HAVE "] = " I HAVE "
       conj[" IM "      ] =\
       conj[" I AM "    ] = " YOU ARE "
       conj[" YOURE "   ] =\
       conj[" YOU ARE " ] = " I AM "

       # table of all answers
       r[1]   = "DONT YOU BELIEVE THAT I CAN  _"
       r[2]   = "PERHAPS YOU WOULD LIKE TO BE ABLE TO _ ?"
       ...

       # table for looking up answers that
       # fit to a certain keyword
       k["CAN YOU"]      = "1 2 3"
       k["CAN I"]        = "4 5"
       k["YOU ARE"]      =\
       k["YOURE"]        = "6 7 8 9"
       ...

     }

Some interesting remarks and details (including the original source code
of ELIZA) are found on Mark Humphrys' home page.  Yahoo!  also has a
page with a collection of ELIZA-like programs. Many of them are written
in Java, some of them disclosing the Java source code, and a few even
explain how to modify the Java source code.

---------- Footnotes ----------

(1) The version shown here is abbreviated.  The full version comes with
the `gawk' distribution.


File: gawkinet.info,  Node: Caveats,  Next: Challenges,  Prev: Simple Server,  Up: Using Networking

2.11 Network Programming Caveats
================================

By now it should be clear that debugging a networked application is more
complicated than debugging a single-process single-hosted application.
The behavior of a networked application sometimes looks noncausal
because it is not reproducible in a strong sense. Whether a network
application works or not sometimes depends on the following:

   * How crowded the underlying network is

   * If the party at the other end is running or not

   * The state of the party at the other end

The most difficult problems for a beginner arise from the hidden states
of the underlying network. After closing a TCP connection, it's often
necessary to wait a short while before reopening the connection. Even
more difficult is the establishment of a connection that previously
ended with a "broken pipe."  Those connections have to "time out" for a
minute or so before they can reopen.  Check this with the command
`netstat -a', which provides a list of still "active" connections.


File: gawkinet.info,  Node: Challenges,  Prev: Caveats,  Up: Using Networking

2.12 Where To Go From Here
==========================

Now, you have learned enough to build your own application. You could,
for example, take part in the Loebner Contest to win $100,000.  The
Loebner Prize is the first formal instantiation of a Turing Test. Hugh
Loebner agreed with The Cambridge Center for Behavioral Studies to
underwrite a contest designed to implement the Turing Test.  Dr.
Loebner pledged a Grand Prize of $100,000 for the first computer whose
responses were indistinguishable from a human's. Each year an annual
prize of $2000 and a bronze medal is awarded to the _most_ human
computer.  The winner of the annual contest is the best entry relative
to other entries that year, irrespective of how good it is in an
absolute sense. Here is an example of a conversation with the winning
program of 1997:

     (c)1997 Cambridge Center For Behavioral Studies all rights reserved [CONVERSE]
     [Intelligent Research Ltd.] Start at: [1997/04/29 08:59:40]
     PROGRAM[10:39:20]Hi, my name is Catherine, what's yours?
     JUDGE02[10:39:36]My name is Nathan.
     PROGRAM[10:39:37]Well, it's nice to meet you, Nathan.
     PROGRAM[10:39:45]Did you see that story on CNN last night about the lesbian
     PROGRAM[10:40:03]couple who came out at a White House party on Sunday?
     JUDGE02[10:40:45]No.  I'm sorry I missed that.  How did the Prez take it?
     PROGRAM[10:40:47]Ellen Degeneres was one of them - she was kissing her lover
     PROGRAM[10:41:08]in front of Bill Clinton. Do you think he was very
     PROGRAM[10:41:21]embarrassed?
     JUDGE02[10:41:37]You tell me.  I didn't see it.
     PROGRAM[10:41:38]Are you still a Friend of Bill Clinton?
     JUDGE02[10:42:22]Yes.  I would like to talk about something else.  Do you know anything about sculpture.
     PROGRAM[10:42:24]Well, I suppose he's doing his best like most of us, but he
     PROGRAM[10:42:35]does seem to attract an UNUSUAL amount of bad publicity,
     PROGRAM[10:42:51]wouldnt you say--can it all be bad luck?
     JUDGE02[10:43:20]I asked you if you knew anything about sculpture.
     PROGRAM[10:43:21]OK, but what happens now--does it all drift on, with
     PROGRAM[10:43:36]everyone waiting to see how much his friends have said about
     PROGRAM[10:43:47]him under threat of lots and lots of jail-or will something
     PROGRAM[10:44:01]dramatic actually happen?
     JUDGE02[10:44:19]Do you know what sculpture is?
     PROGRAM[10:44:20]Well, youre more a fan of his than I am I guess---though I
     PROGRAM[10:44:34]cant SWEAR what Id have done in that locked hotel room, I
     PROGRAM[10:44:51]must say.
     JUDGE02[10:45:26]Have you ever been to the Salmagundi Club?
     PROGRAM[10:45:29]Never. to go back to the original discussion Time to get
     PROGRAM[10:45:43]off this one I think and onto something more down to earth!
     JUDGE02[10:46:20]What is more down to earth than art?
     PROGRAM[10:46:21]I don't know what -- to be honest. -
     PROGRAM[10:46:30]I suppose it depends on where you're coming from, but as the
     PROGRAM[10:46:46]song goes in My Fair Lady, "Why can't a woman be more like a
     PROGRAM[10:47:03]man? "
     JUDGE02[10:47:52]I liked that song but I prefer "Why can't children be more like we are"
     JUDGE02[10:48:10]from another play the name of which I cannot remember.
     PROGRAM[10:48:12]What, if anything, do you enjoy about being a man?
     JUDGE02[10:49:01]I would enjoy all aspects of life no matter what my gender.
     PROGRAM[10:49:02]Do you think of yourself as being attractive?

This program insists on always speaking about the same story around Bill
Clinton. You see, even a program with a rather narrow mind can behave so
much like a human being that it can win this prize. It is quite common
to let these programs talk to each other via network connections. But
during the competition itself, the program and its computer have to be
present at the place the competition is held. We all would love to see
a `gawk' program win in such an event. Maybe it is up to you to
accomplish this?

Some other ideas for useful networked applications:
   * Read the file `doc/awkforai.txt' in the `gawk' distribution.  It
     was written by Ronald P. Loui (Associate Professor of Computer
     Science, at Washington University in St. Louis,
     <loui@ai.wustl.edu>) and summarizes why he teaches `gawk' to
     students of Artificial Intelligence. Here are some passages from
     the text:

          The GAWK manual can be consumed in a single lab session and
          the language can be mastered by the next morning by the
          average student.  GAWK's automatic initialization, implicit
          coercion, I/O support and lack of pointers forgive many of
          the mistakes that young programmers are likely to make.
          Those who have seen C but not mastered it are happy to see
          that GAWK retains some of the same sensibilities while adding
          what must be regarded as spoonsful of syntactic sugar.
          ...
          There are further simple answers.  Probably the best is the
          fact that increasingly, undergraduate AI programming is
          involving the Web.  Oren Etzioni (University of Washington,
          Seattle) has for a while been arguing that the "softbot" is
          replacing the mechanical engineers' robot as the most
          glamorous AI testbed.  If the artifact whose behavior needs
          to be controlled in an intelligent way is the software agent,
          then a language that is well-suited to controlling the
          software environment is the appropriate language.  That would
          imply a scripting language.  If the robot is KAREL, then the
          right language is "turn left; turn right." If the robot is
          Netscape, then the right language is something that can
          generate `netscape -remote
          'openURL(http://cs.wustl.edu/~loui)'' with elan.
          ...
          AI programming requires high-level thinking.  There have
          always been a few gifted programmers who can write high-level
          programs in assembly language.  Most however need the ambient
          abstraction to have a higher floor.
          ...
          Second, inference is merely the expansion of notation.  No
          matter whether the logic that underlies an AI program is
          fuzzy, probabilistic, deontic, defeasible, or deductive, the
          logic merely defines how strings can be transformed into
          other strings.  A language that provides the best support for
          string processing in the end provides the best support for
          logic, for the exploration of various logics, and for most
          forms of symbolic processing that AI might choose to call
          "reasoning" instead of "logic."  The implication is that
          PROLOG, which saves the AI programmer from having to write a
          unifier, saves perhaps two dozen lines of GAWK code at the
          expense of strongly biasing the logic and representational
          expressiveness of any approach.

     Now that `gawk' itself can connect to the Internet, it should be
     obvious that it is suitable for writing intelligent web agents.

   * `awk' is strong at pattern recognition and string processing.  So,
     it is well suited to the classic problem of language translation.
     A first try could be a program that knows the 100 most frequent
     English words and their counterparts in German or French. The
     service could be implemented by regularly reading email with the
     program above, replacing each word by its translation and sending
     the translation back via SMTP.  Users would send English email to
     their translation service and get back a translated email message
     in return. As soon as this works, more effort can be spent on a
     real translation program.

   * Another dialogue-oriented application (on the verge of ridicule)
     is the email "support service." Troubled customers write an email
     to an automatic `gawk' service that reads the email. It looks for
     keywords in the mail and assembles a reply email accordingly. By
     carefully investigating the email header, and repeating these
     keywords through the reply email, it is rather simple to give the
     customer a feeling that someone cares. Ideally, such a service
     would search a database of previous cases for solutions. If none
     exists, the database could, for example, consist of all the
     newsgroups, mailing lists and FAQs on the Internet.


File: gawkinet.info,  Node: Some Applications and Techniques,  Next: Links,  Prev: Using Networking,  Up: Top

3 Some Applications and Techniques
**********************************

In this major node, we look at a number of self-contained scripts, with
an emphasis on concise networking.  Along the way, we work towards
creating building blocks that encapsulate often needed functions of the
networking world, show new techniques that broaden the scope of
problems that can be solved with `gawk', and explore leading edge
technology that may shape the future of networking.

We often refer to the site-independent core of the server that we built
in *Note A Simple Web Server: Simple Server.  When building new and
nontrivial servers, we always copy this building block and append new
instances of the two functions `SetUpServer' and `HandleGET'.

This makes a lot of sense, since this scheme of event-driven execution
provides `gawk' with an interface to the most widely accepted standard
for GUIs: the web browser. Now, `gawk' can rival even Tcl/Tk.

Tcl and `gawk' have much in common. Both are simple scripting languages
that allow us to quickly solve problems with short programs. But Tcl
has Tk on top of it, and `gawk' had nothing comparable up to now. While
Tcl needs a large and ever-changing library (Tk, which was bound to the
X Window System until recently), `gawk' needs just the networking
interface and some kind of browser on the client's side. Besides better
portability, the most important advantage of this approach (embracing
well-established standards such HTTP and HTML) is that _we do not need
to change the language_. We let others do the work of fighting over
protocols and standards.  We can use HTML, JavaScript, VRML, or
whatever else comes along to do our work.

* Menu:

* PANIC::                       An Emergency Web Server.
* GETURL::                      Retrieving Web Pages.
* REMCONF::                     Remote Configuration Of Embedded Systems.
* URLCHK::                      Look For Changed Web Pages.
* WEBGRAB::                     Extract Links From A Page.
* STATIST::                     Graphing A Statistical Distribution.
* MAZE::                        Walking Through A Maze In Virtual Reality.
* MOBAGWHO::                    A Simple Mobile Agent.
* STOXPRED::                    Stock Market Prediction As A Service.
* PROTBASE::                    Searching Through A Protein Database.


File: gawkinet.info,  Node: PANIC,  Next: GETURL,  Prev: Some Applications and Techniques,  Up: Some Applications and Techniques

3.1 PANIC: An Emergency Web Server
==================================

At first glance, the `"Hello, world"' example in *Note A Primitive Web
Service: Primitive Service, seems useless. By adding just a few lines,
we can turn it into something useful.

The PANIC program tells everyone who connects that the local site is
not working. When a web server breaks down, it makes a difference if
customers get a strange "network unreachable" message, or a short
message telling them that the server has a problem. In such an
emergency, the hard disk and everything on it (including the regular
web service) may be unavailable. Rebooting the web server off a
diskette makes sense in this setting.

To use the PANIC program as an emergency web server, all you need are
the `gawk' executable and the program below on a diskette. By default,
it connects to port 8080. A different value may be supplied on the
command line:

     BEGIN {
       RS = ORS = "\r\n"
       if (MyPort ==  0) MyPort = 8080
       HttpService = "/inet/tcp/" MyPort "/0/0"
       Hello = "<HTML><HEAD><TITLE>Out Of Service</TITLE>" \
          "</HEAD><BODY><H1>" \
          "This site is temporarily out of service." \
          "</H1></BODY></HTML>"
       Len = length(Hello) + length(ORS)
       while ("awk" != "complex") {
         print "HTTP/1.0 200 OK"          |& HttpService
         print "Content-Length: " Len ORS |& HttpService
         print Hello                      |& HttpService
         while ((HttpService |& getline) > 0)
            continue;
         close(HttpService)
       }
     }


File: gawkinet.info,  Node: GETURL,  Next: REMCONF,  Prev: PANIC,  Up: Some Applications and Techniques

3.2 GETURL: Retrieving Web Pages
================================

GETURL is a versatile building block for shell scripts that need to
retrieve files from the Internet. It takes a web address as a
command-line parameter and tries to retrieve the contents of this
address. The contents are printed to standard output, while the header
is printed to `/dev/stderr'.  A surrounding shell script could analyze
the contents and extract the text or the links. An ASCII browser could
be written around GETURL. But more interestingly, web robots are
straightforward to write on top of GETURL. On the Internet, you can find
several programs of the same name that do the same job. They are usually
much more complex internally and at least 10 times longer.

At first, GETURL checks if it was called with exactly one web address.
Then, it checks if the user chose to use a special proxy server whose
name is handed over in a variable. By default, it is assumed that the
local machine serves as proxy. GETURL uses the `GET' method by default
to access the web page. By handing over the name of a different method
(such as `HEAD'), it is possible to choose a different behavior. With
the `HEAD' method, the user does not receive the body of the page
content, but does receive the header:

     BEGIN {
       if (ARGC != 2) {
         print "GETURL - retrieve Web page via HTTP 1.0"
         print "IN:\n    the URL as a command-line parameter"
         print "PARAM(S):\n    -v Proxy=MyProxy"
         print "OUT:\n    the page content on stdout"
         print "    the page header on stderr"
         print "JK 16.05.1997"
         print "ADR 13.08.2000"
         exit
       }
       URL = ARGV[1]; ARGV[1] = ""
       if (Proxy     == "")  Proxy     = "127.0.0.1"
       if (ProxyPort ==  0)  ProxyPort = 80
       if (Method    == "")  Method    = "GET"
       HttpService = "/inet/tcp/0/" Proxy "/" ProxyPort
       ORS = RS = "\r\n\r\n"
       print Method " " URL " HTTP/1.0" |& HttpService
       HttpService                      |& getline Header
       print Header > "/dev/stderr"
       while ((HttpService |& getline) > 0)
         printf "%s", $0
       close(HttpService)
     }

This program can be changed as needed, but be careful with the last
lines.  Make sure transmission of binary data is not corrupted by
additional line breaks. Even as it is now, the byte sequence
`"\r\n\r\n"' would disappear if it were contained in binary data. Don't
get caught in a trap when trying a quick fix on this one.


File: gawkinet.info,  Node: REMCONF,  Next: URLCHK,  Prev: GETURL,  Up: Some Applications and Techniques

3.3 REMCONF: Remote Configuration of Embedded Systems
=====================================================

Today, you often find powerful processors in embedded systems.
Dedicated network routers and controllers for all kinds of machinery
are examples of embedded systems. Processors like the Intel 80x86 or
the AMD Elan are able to run multitasking operating systems, such as
XINU or GNU/Linux in embedded PCs.  These systems are small and usually
do not have a keyboard or a display.  Therefore it is difficult to set
up their configuration. There are several widespread ways to set them
up:

   * DIP switches

   * Read Only Memories such as EPROMs

   * Serial lines or some kind of keyboard

   * Network connections via `telnet' or SNMP

   * HTTP connections with HTML GUIs

In this node, we look at a solution that uses HTTP connections to
control variables of an embedded system that are stored in a file.
Since embedded systems have tight limits on resources like memory, it
is difficult to employ advanced techniques such as SNMP and HTTP
servers. `gawk' fits in quite nicely with its single executable which
needs just a short script to start working.  The following program
stores the variables in a file, and a concurrent process in the
embedded system may read the file. The program uses the
site-independent part of the simple web server that we developed in
*Note A Web Service with Interaction: Interacting Service.  As
mentioned there, all we have to do is to write two new procedures
`SetUpServer' and `HandleGET':

     function SetUpServer() {
       TopHeader = "<HTML><title>Remote Configuration</title>"
       TopDoc = "<BODY>\
         <h2>Please choose one of the following actions:</h2>\
         <UL>\
           <LI><A HREF=" MyPrefix "/AboutServer>About this server</A></LI>\
           <LI><A HREF=" MyPrefix "/ReadConfig>Read Configuration</A></LI>\
           <LI><A HREF=" MyPrefix "/CheckConfig>Check Configuration</A></LI>\
           <LI><A HREF=" MyPrefix "/ChangeConfig>Change Configuration</A></LI>\
           <LI><A HREF=" MyPrefix "/SaveConfig>Save Configuration</A></LI>\
         </UL>"
       TopFooter  = "</BODY></HTML>"
       if (ConfigFile == "") ConfigFile = "config.asc"
     }

The function `SetUpServer' initializes the top level HTML texts as
usual. It also initializes the name of the file that contains the
configuration parameters and their values. In case the user supplies a
name from the command line, that name is used. The file is expected to
contain one parameter per line, with the name of the parameter in
column one and the value in column two.

The function `HandleGET' reflects the structure of the menu tree as
usual. The first menu choice tells the user what this is all about. The
second choice reads the configuration file line by line and stores the
parameters and their values. Notice that the record separator for this
file is `"\n"', in contrast to the record separator for HTTP. The third
menu choice builds an HTML table to show the contents of the
configuration file just read. The fourth choice does the real work of
changing parameters, and the last one just saves the configuration into
a file:

     function HandleGET() {
       if(MENU[2] == "AboutServer") {
         Document  = "This is a GUI for remote configuration of an\
           embedded system. It is is implemented as one GAWK script."
       } else if (MENU[2] == "ReadConfig") {
         RS = "\n"
         while ((getline < ConfigFile) > 0)
            config[$1] = $2;
         close(ConfigFile)
         RS = "\r\n"
         Document = "Configuration has been read."
       } else if (MENU[2] == "CheckConfig") {
         Document = "<TABLE BORDER=1 CELLPADDING=5>"
         for (i in config)
           Document = Document "<TR><TD>" i "</TD>" \
             "<TD>" config[i] "</TD></TR>"
         Document = Document "</TABLE>"
       } else if (MENU[2] == "ChangeConfig") {
         if ("Param" in GETARG) {            # any parameter to set?
           if (GETARG["Param"] in config) {  # is  parameter valid?
             config[GETARG["Param"]] = GETARG["Value"]
             Document = (GETARG["Param"] " = " GETARG["Value"] ".")
           } else {
             Document = "Parameter <b>" GETARG["Param"] "</b> is invalid."
           }
         } else {
           Document = "<FORM method=GET><h4>Change one parameter</h4>\
             <TABLE BORDER CELLPADDING=5>\
             <TR><TD>Parameter</TD><TD>Value</TD></TR>\
             <TR><TD><input type=text name=Param value=\"\" size=20></TD>\
                 <TD><input type=text name=Value value=\"\" size=40></TD>\
             </TR></TABLE><input type=submit value=\"Set\"></FORM>"
         }
       } else if (MENU[2] == "SaveConfig") {
         for (i in config)
           printf("%s %s\n", i, config[i]) > ConfigFile
         close(ConfigFile)
         Document = "Configuration has been saved."
       }
     }

We could also view the configuration file as a database. From this
point of view, the previous program acts like a primitive database
server.  Real SQL database systems also make a service available by
providing a TCP port that clients can connect to. But the application
level protocols they use are usually proprietary and also change from
time to time.  This is also true for the protocol that MiniSQL uses.


File: gawkinet.info,  Node: URLCHK,  Next: WEBGRAB,  Prev: REMCONF,  Up: Some Applications and Techniques

3.4 URLCHK: Look for Changed Web Pages
======================================

Most people who make heavy use of Internet resources have a large
bookmark file with pointers to interesting web sites. It is impossible
to regularly check by hand if any of these sites have changed. A program
is needed to automatically look at the headers of web pages and tell
which ones have changed. URLCHK does the comparison after using GETURL
with the `HEAD' method to retrieve the header.

Like GETURL, this program first checks that it is called with exactly
one command-line parameter. URLCHK also takes the same command-line
variables `Proxy' and `ProxyPort' as GETURL, because these variables
are handed over to GETURL for each URL that gets checked. The one and
only parameter is the name of a file that contains one line for each
URL. In the first column, we find the URL, and the second and third
columns hold the length of the URL's body when checked for the two last
times. Now, we follow this plan:

  1. Read the URLs from the file and remember their most recent lengths

  2. Delete the contents of the file

  3. For each URL, check its new length and write it into the file

  4. If the most recent and the new length differ, tell the user

It may seem a bit peculiar to read the URLs from a file together with
their two most recent lengths, but this approach has several
advantages. You can call the program again and again with the same
file. After running the program, you can regenerate the changed URLs by
extracting those lines that differ in their second and third columns:

     BEGIN {
       if (ARGC != 2) {
         print "URLCHK - check if URLs have changed"
         print "IN:\n    the file with URLs as a command-line parameter"
         print "    file contains URL, old length, new length"
         print "PARAMS:\n    -v Proxy=MyProxy -v ProxyPort=8080"
         print "OUT:\n    same as file with URLs"
         print "JK 02.03.1998"
         exit
       }
       URLfile = ARGV[1]; ARGV[1] = ""
       if (Proxy     != "") Proxy     = " -v Proxy="     Proxy
       if (ProxyPort != "") ProxyPort = " -v ProxyPort=" ProxyPort
       while ((getline < URLfile) > 0)
          Length[$1] = $3 + 0
       close(URLfile)      # now, URLfile is read in and can be updated
       GetHeader = "gawk " Proxy ProxyPort " -v Method=\"HEAD\" -f geturl.awk "
       for (i in Length) {
         GetThisHeader = GetHeader i " 2>&1"
         while ((GetThisHeader | getline) > 0)
           if (toupper($0) ~ /CONTENT-LENGTH/) NewLength = $2 + 0
         close(GetThisHeader)
         print i, Length[i], NewLength > URLfile
         if (Length[i] != NewLength)  # report only changed URLs
           print i, Length[i], NewLength
       }
       close(URLfile)
     }

Another thing that may look strange is the way GETURL is called.
Before calling GETURL, we have to check if the proxy variables need to
be passed on. If so, we prepare strings that will become part of the
command line later. In `GetHeader', we store these strings together
with the longest part of the command line. Later, in the loop over the
URLs, `GetHeader' is appended with the URL and a redirection operator
to form the command that reads the URL's header over the Internet.
GETURL always produces the headers over `/dev/stderr'. That is the
reason why we need the redirection operator to have the header piped in.

This program is not perfect because it assumes that changing URLs
results in changed lengths, which is not necessarily true. A more
advanced approach is to look at some other header line that holds time
information. But, as always when things get a bit more complicated,
this is left as an exercise to the reader.


File: gawkinet.info,  Node: WEBGRAB,  Next: STATIST,  Prev: URLCHK,  Up: Some Applications and Techniques

3.5 WEBGRAB: Extract Links from a Page
======================================

Sometimes it is necessary to extract links from web pages.  Browsers do
it, web robots do it, and sometimes even humans do it.  Since we have a
tool like GETURL at hand, we can solve this problem with some help from
the Bourne shell:

     BEGIN { RS = "http://[#%&\\+\\-\\./0-9\\:;\\?A-Z_a-z\\~]*" }
     RT != "" {
        command = ("gawk -v Proxy=MyProxy -f geturl.awk " RT \
                    " > doc" NR ".html")
        print command
     }

Notice that the regular expression for URLs is rather crude. A precise
regular expression is much more complex. But this one works rather
well. One problem is that it is unable to find internal links of an
HTML document.  Another problem is that `ftp', `telnet', `news',
`mailto', and other kinds of links are missing in the regular
expression.  However, it is straightforward to add them, if doing so is
necessary for other tasks.

This program reads an HTML file and prints all the HTTP links that it
finds.  It relies on `gawk''s ability to use regular expressions as
record separators. With `RS' set to a regular expression that matches
links, the second action is executed each time a non-empty link is
found.  We can find the matching link itself in `RT'.

The action could use the `system' function to let another GETURL
retrieve the page, but here we use a different approach.  This simple
program prints shell commands that can be piped into `sh' for
execution.  This way it is possible to first extract the links, wrap
shell commands around them, and pipe all the shell commands into a
file. After editing the file, execution of the file retrieves exactly
those files that we really need. In case we do not want to edit, we can
retrieve all the pages like this:

     gawk -f geturl.awk http://www.suse.de | gawk -f webgrab.awk | sh

After this, you will find the contents of all referenced documents in
files named `doc*.html' even if they do not contain HTML code.  The
most annoying thing is that we always have to pass the proxy to GETURL.
If you do not like to see the headers of the web pages appear on the
screen, you can redirect them to `/dev/null'.  Watching the headers
appear can be quite interesting, because it reveals interesting details
such as which web server the companies use.  Now, it is clear how the
clever marketing people use web robots to determine the market shares
of Microsoft and Netscape in the web server market.

Port 80 of any web server is like a small hole in a repellent firewall.
After attaching a browser to port 80, we usually catch a glimpse of the
bright side of the server (its home page). With a tool like GETURL at
hand, we are able to discover some of the more concealed or even
"indecent" services (i.e., lacking conformity to standards of quality).
It can be exciting to see the fancy CGI scripts that lie there,
revealing the inner workings of the server, ready to be called:

   * With a command such as:

          gawk -f geturl.awk http://any.host.on.the.net/cgi-bin/

     some servers give you a directory listing of the CGI files.
     Knowing the names, you can try to call some of them and watch for
     useful results. Sometimes there are executables in such directories
     (such as Perl interpreters) that you may call remotely. If there
     are subdirectories with configuration data of the web server, this
     can also be quite interesting to read.

   * The well-known Apache web server usually has its CGI files in the
     directory `/cgi-bin'. There you can often find the scripts
     `test-cgi' and `printenv'. Both tell you some things about the
     current connection and the installation of the web server.  Just
     call:

          gawk -f geturl.awk http://any.host.on.the.net/cgi-bin/test-cgi
          gawk -f geturl.awk http://any.host.on.the.net/cgi-bin/printenv

   * Sometimes it is even possible to retrieve system files like the web
     server's log file--possibly containing customer data--or even the
     file `/etc/passwd'.  (We don't recommend this!)

*Caution:* Although this may sound funny or simply irrelevant, we are
talking about severe security holes. Try to explore your own system
this way and make sure that none of the above reveals too much
information about your system.


File: gawkinet.info,  Node: STATIST,  Next: MAZE,  Prev: WEBGRAB,  Up: Some Applications and Techniques

3.6 STATIST: Graphing a Statistical Distribution
================================================

In the HTTP server examples we've shown thus far, we never present an
image to the browser and its user. Presenting images is one task.
Generating images that reflect some user input and presenting these
dynamically generated images is another. In this node, we use GNUPlot
for generating `.png', `.ps', or `.gif' files.(1)

The program we develop takes the statistical parameters of two samples
and computes the t-test statistics. As a result, we get the
probabilities that the means and the variances of both samples are the
same. In order to let the user check plausibility, the program presents
an image of the distributions. The statistical computation follows
`Numerical Recipes in C: The Art of Scientific Computing' by William H.
Press, Saul A. Teukolsky, William T. Vetterling, and Brian P. Flannery.
Since `gawk' does not have a built-in function for the computation of
the beta function, we use the `ibeta' function of GNUPlot. As a side
effect, we learn how to use GNUPlot as a sophisticated calculator. The
comparison of means is done as in `tutest', paragraph 14.2, page 613,
and the comparison of variances is done as in `ftest', page 611 in
`Numerical Recipes'.  

As usual, we take the site-independent code for servers and append our
own functions `SetUpServer' and `HandleGET':

     function SetUpServer() {
       TopHeader = "<HTML><title>Statistics with GAWK</title>"
       TopDoc = "<BODY>\
        <h2>Please choose one of the following actions:</h2>\
        <UL>\
         <LI><A HREF=" MyPrefix "/AboutServer>About this server</A></LI>\
         <LI><A HREF=" MyPrefix "/EnterParameters>Enter Parameters</A></LI>\
        </UL>"
       TopFooter  = "</BODY></HTML>"
       GnuPlot    = "gnuplot 2>&1"
       m1=m2=0;    v1=v2=1;    n1=n2=10
     }

Here, you see the menu structure that the user sees. Later, we will see
how the program structure of the `HandleGET' function reflects the menu
structure. What is missing here is the link for the image we generate.
In an event-driven environment, request, generation, and delivery of
images are separated.

Notice the way we initialize the `GnuPlot' command string for the pipe.
By default, GNUPlot outputs the generated image via standard output, as
well as the results of `print'(ed) calculations via standard error.
The redirection causes standard error to be mixed into standard output,
enabling us to read results of calculations with `getline'.  By
initializing the statistical parameters with some meaningful defaults,
we make sure the user gets an image the first time he uses the program.

Following is the rather long function `HandleGET', which implements the
contents of this service by reacting to the different kinds of requests
from the browser. Before you start playing with this script, make sure
that your browser supports JavaScript and that it also has this option
switched on. The script uses a short snippet of JavaScript code for
delayed opening of a window with an image.  A more detailed explanation
follows:

     function HandleGET() {
       if(MENU[2] == "AboutServer") {
         Document  = "This is a GUI for a statistical computation.\
           It compares means and variances of two distributions.\
           It is implemented as one GAWK script and uses GNUPLOT."
       } else if (MENU[2] == "EnterParameters") {
         Document = ""
         if ("m1" in GETARG) {     # are there parameters to compare?
           Document = Document "<SCRIPT LANGUAGE=\"JavaScript\">\
             setTimeout(\"window.open(\\\"" MyPrefix "/Image" systime()\
              "\\\",\\\"dist\\\", \\\"status=no\\\");\", 1000); </SCRIPT>"
           m1 = GETARG["m1"]; v1 = GETARG["v1"]; n1 = GETARG["n1"]
           m2 = GETARG["m2"]; v2 = GETARG["v2"]; n2 = GETARG["n2"]
           t = (m1-m2)/sqrt(v1/n1+v2/n2)
           df = (v1/n1+v2/n2)*(v1/n1+v2/n2)/((v1/n1)*(v1/n1)/(n1-1) \
                + (v2/n2)*(v2/n2) /(n2-1))
           if (v1>v2) {
               f = v1/v2
               df1 = n1 - 1
               df2 = n2 - 1
           } else {
               f = v2/v1
               df1 = n2 - 1
               df2 = n1 - 1
           }
           print "pt=ibeta(" df/2 ",0.5," df/(df+t*t) ")"  |& GnuPlot
           print "pF=2.0*ibeta(" df2/2 "," df1/2 "," \
                 df2/(df2+df1*f) ")"                    |& GnuPlot
           print "print pt, pF"                         |& GnuPlot
           RS="\n"; GnuPlot |& getline; RS="\r\n"    # $1 is pt, $2 is pF
           print "invsqrt2pi=1.0/sqrt(2.0*pi)"          |& GnuPlot
           print "nd(x)=invsqrt2pi/sd*exp(-0.5*((x-mu)/sd)**2)" |& GnuPlot
           print "set term png small color"             |& GnuPlot
           #print "set term postscript color"           |& GnuPlot
           #print "set term gif medium size 320,240"    |& GnuPlot
           print "set yrange[-0.3:]"                    |& GnuPlot
           print "set label 'p(m1=m2) =" $1 "' at 0,-0.1 left"  |& GnuPlot
           print "set label 'p(v1=v2) =" $2 "' at 0,-0.2 left"  |& GnuPlot
           print "plot mu=" m1 ",sd=" sqrt(v1) ", nd(x) title 'sample 1',\
             mu=" m2 ",sd=" sqrt(v2) ", nd(x) title 'sample 2'" |& GnuPlot
           print "quit"                                         |& GnuPlot
           GnuPlot |& getline Image
           while ((GnuPlot |& getline) > 0)
               Image = Image RS $0
           close(GnuPlot)
         }
         Document = Document "\
         <h3>Do these samples have the same Gaussian distribution?</h3>\
         <FORM METHOD=GET> <TABLE BORDER CELLPADDING=5>\
         <TR>\
         <TD>1. Mean    </TD>
         <TD><input type=text name=m1 value=" m1 " size=8></TD>\
         <TD>1. Variance</TD>
         <TD><input type=text name=v1 value=" v1 " size=8></TD>\
         <TD>1. Count   </TD>
         <TD><input type=text name=n1 value=" n1 " size=8></TD>\
         </TR><TR>\
         <TD>2. Mean    </TD>
         <TD><input type=text name=m2 value=" m2 " size=8></TD>\
         <TD>2. Variance</TD>
         <TD><input type=text name=v2 value=" v2 " size=8></TD>\
         <TD>2. Count   </TD>
         <TD><input type=text name=n2 value=" n2 " size=8></TD>\
         </TR>                   <input type=submit value=\"Compute\">\
         </TABLE></FORM><BR>"
       } else if (MENU[2] ~ "Image") {
         Reason = "OK" ORS "Content-type: image/png"
         #Reason = "OK" ORS "Content-type: application/x-postscript"
         #Reason = "OK" ORS "Content-type: image/gif"
         Header = Footer = ""
         Document = Image
       }
     }

As usual, we give a short description of the service in the first menu
choice. The third menu choice shows us that generation and presentation
of an image are two separate actions. While the latter takes place
quite instantly in the third menu choice, the former takes place in the
much longer second choice. Image data passes from the generating action
to the presenting action via the variable `Image' that contains a
complete `.png' image, which is otherwise stored in a file. If you
prefer `.ps' or `.gif' images over the default `.png' images, you may
select these options by uncommenting the appropriate lines. But
remember to do so in two places: when telling GNUPlot which kind of
images to generate, and when transmitting the image at the end of the
program.

Looking at the end of the program, the way we pass the `Content-type'
to the browser is a bit unusual.  It is appended to the `OK' of the
first header line to make sure the type information becomes part of the
header.  The other variables that get transmitted across the network are
made empty, because in this case we do not have an HTML document to
transmit, but rather raw image data to contain in the body.

Most of the work is done in the second menu choice. It starts with a
strange JavaScript code snippet. When first implementing this server,
we used a short `"<IMG SRC=" MyPrefix "/Image>"' here. But then
browsers got smarter and tried to improve on speed by requesting the
image and the HTML code at the same time. When doing this, the browser
tries to build up a connection for the image request while the request
for the HTML text is not yet completed. The browser tries to connect to
the `gawk' server on port 8080 while port 8080 is still in use for
transmission of the HTML text. The connection for the image cannot be
built up, so the image appears as "broken" in the browser window.  We
solved this problem by telling the browser to open a separate window
for the image, but only after a delay of 1000 milliseconds.  By this
time, the server should be ready for serving the next request.

But there is one more subtlety in the JavaScript code.  Each time the
JavaScript code opens a window for the image, the name of the image is
appended with a timestamp (`systime').  Why this constant change of
name for the image? Initially, we always named the image `Image', but
then the Netscape browser noticed the name had _not_ changed since the
previous request and displayed the previous image (caching behavior).
The server core is implemented so that browsers are told _not_ to cache
anything.  Obviously HTTP requests do not always work as expected. One
way to circumvent the cache of such overly smart browsers is to change
the name of the image with each request. These three lines of JavaScript
caused us a lot of trouble.

The rest can be broken down into two phases. At first, we check if
there are statistical parameters. When the program is first started,
there usually are no parameters because it enters the page coming from
the top menu.  Then, we only have to present the user a form that he
can use to change statistical parameters and submit them. Subsequently,
the submission of the form causes the execution of the first phase
because _now_ there _are_ parameters to handle.

Now that we have parameters, we know there will be an image available.
Therefore we insert the JavaScript code here to initiate the opening of
the image in a separate window. Then, we prepare some variables that
will be passed to GNUPlot for calculation of the probabilities. Prior
to reading the results, we must temporarily change `RS' because GNUPlot
separates lines with newlines.  After instructing GNUPlot to generate a
`.png' (or `.ps' or `.gif') image, we initiate the insertion of some
text, explaining the resulting probabilities. The final `plot' command
actually generates the image data. This raw binary has to be read in
carefully without adding, changing, or deleting a single byte. Hence
the unusual initialization of `Image' and completion with a `while'
loop.

When using this server, it soon becomes clear that it is far from being
perfect. It mixes source code of six scripting languages or protocols:

   * GNU `awk' implements a server for the protocol:

   * HTTP which transmits:

   * HTML text which contains a short piece of:

   * JavaScript code opening a separate window.

   * A Bourne shell script is used for piping commands into:

   * GNUPlot to generate the image to be opened.

After all this work, the GNUPlot image opens in the JavaScript window
where it can be viewed by the user.

It is probably better not to mix up so many different languages.  The
result is not very readable.  Furthermore, the statistical part of the
server does not take care of invalid input.  Among others, using
negative variances will cause invalid results.

---------- Footnotes ----------

(1) Due to licensing problems, the default installation of GNUPlot
disables the generation of `.gif' files.  If your installed version
does not accept `set term gif', just download and install the most
recent version of GNUPlot and the GD library
(http://www.boutell.com/gd/) by Thomas Boutell.  Otherwise you still
have the chance to generate some ASCII-art style images with GNUPlot by
using `set term dumb'.  (We tried it and it worked.)


File: gawkinet.info,  Node: MAZE,  Next: MOBAGWHO,  Prev: STATIST,  Up: Some Applications and Techniques

3.7 MAZE: Walking Through a Maze In Virtual Reality
===================================================

     In the long run, every program becomes rococo, and then rubble.
     Alan Perlis

By now, we know how to present arbitrary `Content-type's to a browser.
In this node, our server will present a 3D world to our browser.  The
3D world is described in a scene description language (VRML, Virtual
Reality Modeling Language) that allows us to travel through a
perspective view of a 2D maze with our browser. Browsers with a VRML
plugin enable exploration of this technology. We could do one of those
boring `Hello world' examples here, that are usually presented when
introducing novices to VRML. If you have never written any VRML code,
have a look at the VRML FAQ.  Presenting a static VRML scene is a bit
trivial; in order to expose `gawk''s new capabilities, we will present
a dynamically generated VRML scene. The function `SetUpServer' is very
simple because it only sets the default HTML page and initializes the
random number generator. As usual, the surrounding server lets you
browse the maze.

     function SetUpServer() {
       TopHeader = "<HTML><title>Walk through a maze</title>"
       TopDoc = "\
         <h2>Please choose one of the following actions:</h2>\
         <UL>\
           <LI><A HREF=" MyPrefix "/AboutServer>About this server</A>\
           <LI><A HREF=" MyPrefix "/VRMLtest>Watch a simple VRML scene</A>\
         </UL>"
       TopFooter  = "</HTML>"
       srand()
     }

The function `HandleGET' is a bit longer because it first computes the
maze and afterwards generates the VRML code that is sent across the
network. As shown in the STATIST example (*note STATIST::), we set the
type of the content to VRML and then store the VRML representation of
the maze as the page content. We assume that the maze is stored in a 2D
array. Initially, the maze consists of walls only. Then, we add an
entry and an exit to the maze and let the rest of the work be done by
the function `MakeMaze'.  Now, only the wall fields are left in the
maze. By iterating over the these fields, we generate one line of VRML
code for each wall field.

     function HandleGET() {
       if (MENU[2] == "AboutServer") {
         Document  = "If your browser has a VRML 2 plugin,\
           this server shows you a simple VRML scene."
       } else if (MENU[2] == "VRMLtest") {
         XSIZE = YSIZE = 11              # initially, everything is wall
         for (y = 0; y < YSIZE; y++)
            for (x = 0; x < XSIZE; x++)
               Maze[x, y] = "#"
         delete Maze[0, 1]              # entry is not wall
         delete Maze[XSIZE-1, YSIZE-2]  # exit  is not wall
         MakeMaze(1, 1)
         Document = "\
     #VRML V2.0 utf8\n\
     Group {\n\
       children [\n\
         PointLight {\n\
           ambientIntensity 0.2\n\
           color 0.7 0.7 0.7\n\
           location 0.0 8.0 10.0\n\
         }\n\
         DEF B1 Background {\n\
           skyColor [0 0 0, 1.0 1.0 1.0 ]\n\
           skyAngle 1.6\n\
           groundColor [1 1 1, 0.8 0.8 0.8, 0.2 0.2 0.2 ]\n\
           groundAngle [ 1.2 1.57 ]\n\
         }\n\
         DEF Wall Shape {\n\
           geometry Box {size 1 1 1}\n\
           appearance Appearance { material Material { diffuseColor 0 0 1 } }\n\
         }\n\
         DEF Entry Viewpoint {\n\
           position 0.5 1.0 5.0\n\
           orientation 0.0 0.0 -1.0 0.52\n\
         }\n"
         for (i in Maze) {
           split(i, t, SUBSEP)
           Document = Document "    Transform { translation "
           Document = Document t[1] " 0 -" t[2] " children USE Wall }\n"
         }
         Document = Document "  ] # end of group for world\n}"
         Reason = "OK" ORS "Content-type: model/vrml"
         Header = Footer = ""
       }
     }

Finally, we have a look at `MakeMaze', the function that generates the
`Maze' array. When entered, this function assumes that the array has
been initialized so that each element represents a wall element and the
maze is initially full of wall elements. Only the entrance and the exit
of the maze should have been left free. The parameters of the function
tell us which element must be marked as not being a wall. After this,
we take a look at the four neighbouring elements and remember which we
have already treated. Of all the neighbouring elements, we take one at
random and walk in that direction. Therefore, the wall element in that
direction has to be removed and then, we call the function recursively
for that element.  The maze is only completed if we iterate the above
procedure for _all_ neighbouring elements (in random order) and for our
present element by recursively calling the function for the present
element. This last iteration could have been done in a loop, but it is
done much simpler recursively.

Notice that elements with coordinates that are both odd are assumed to
be on our way through the maze and the generating process cannot
terminate as long as there is such an element not being `delete'd. All
other elements are potentially part of the wall.

     function MakeMaze(x, y) {
       delete Maze[x, y]     # here we are, we have no wall here
       p = 0                 # count unvisited fields in all directions
       if (x-2 SUBSEP y   in Maze) d[p++] = "-x"
       if (x   SUBSEP y-2 in Maze) d[p++] = "-y"
       if (x+2 SUBSEP y   in Maze) d[p++] = "+x"
       if (x   SUBSEP y+2 in Maze) d[p++] = "+y"
       if (p>0) {            # if there are univisited fields, go there
         p = int(p*rand())   # choose one unvisited field at random
         if        (d[p] == "-x") { delete Maze[x - 1, y]; MakeMaze(x - 2, y)
         } else if (d[p] == "-y") { delete Maze[x, y - 1]; MakeMaze(x, y - 2)
         } else if (d[p] == "+x") { delete Maze[x + 1, y]; MakeMaze(x + 2, y)
         } else if (d[p] == "+y") { delete Maze[x, y + 1]; MakeMaze(x, y + 2)
         }                   # we are back from recursion
         MakeMaze(x, y);     # try again while there are unvisited fields
       }
     }


File: gawkinet.info,  Node: MOBAGWHO,  Next: STOXPRED,  Prev: MAZE,  Up: Some Applications and Techniques

3.8 MOBAGWHO: a Simple Mobile Agent
===================================

     There are two ways of constructing a software design: One way is to
     make it so simple that there are obviously no deficiencies, and the
     other way is to make it so complicated that there are no obvious
     deficiencies.
     C. A. R. Hoare

A "mobile agent" is a program that can be dispatched from a computer and
transported to a remote server for execution. This is called
"migration", which means that a process on another system is started
that is independent from its originator. Ideally, it wanders through a
network while working for its creator or owner. In places like the UMBC
Agent Web, people are quite confident that (mobile) agents are a
software engineering paradigm that enables us to significantly increase
the efficiency of our work. Mobile agents could become the mediators
between users and the networking world. For an unbiased view at this
technology, see the remarkable paper `Mobile Agents: Are they a good
idea?'.(1)

When trying to migrate a process from one system to another, a server
process is needed on the receiving side. Depending on the kind of
server process, several ways of implementation come to mind.  How the
process is implemented depends upon the kind of server process:

   * HTTP can be used as the protocol for delivery of the migrating
     process. In this case, we use a common web server as the receiving
     server process. A universal CGI script mediates between migrating
     process and web server.  Each server willing to accept migrating
     agents makes this universal service available. HTTP supplies the
     `POST' method to transfer some data to a file on the web server.
     When a CGI script is called remotely with the `POST' method
     instead of the usual `GET' method, data is transmitted from the
     client process to the standard input of the server's CGI script.
     So, to implement a mobile agent, we must not only write the agent
     program to start on the client side, but also the CGI script to
     receive the agent on the server side.

   * The `PUT' method can also be used for migration. HTTP does not
     require a CGI script for migration via `PUT'. However, with common
     web servers there is no advantage to this solution, because web
     servers such as Apache require explicit activation of a special
     `PUT' script.

   * `Agent Tcl' pursues a different course; it relies on a dedicated
     server process with a dedicated protocol specialized for receiving
     mobile agents.

Our agent example abuses a common web server as a migration tool. So,
it needs a universal CGI script on the receiving side (the web server).
The receiving script is activated with a `POST' request when placed
into a location like `/httpd/cgi-bin/PostAgent.sh'. Make sure that the
server system uses a version of `gawk' that supports network access
(Version 3.1 or later; verify with `gawk --version').

     #!/bin/sh
     MobAg=/tmp/MobileAgent.$$
     # direct script to mobile agent file
     cat > $MobAg
     # execute agent concurrently
     gawk -f $MobAg $MobAg > /dev/null &
     # HTTP header, terminator and body
     gawk 'BEGIN { print "\r\nAgent started" }'
     rm $MobAg      # delete script file of agent

By making its process id (`$$') part of the unique file name, the
script avoids conflicts between concurrent instances of the script.
First, all lines from standard input (the mobile agent's source code)
are copied into this unique file. Then, the agent is started as a
concurrent process and a short message reporting this fact is sent to
the submitting client.  Finally, the script file of the mobile agent is
removed because it is no longer needed. Although it is a short script,
there are several noteworthy points:

Security
     _There is none_. In fact, the CGI script should never be made
     available on a server that is part of the Internet because everyone
     would be allowed to execute arbitrary commands with it. This
     behavior is acceptable only when performing rapid prototyping.

Self-Reference
     Each migrating instance of an agent is started in a way that
     enables it to read its own source code from standard input and use
     the code for subsequent migrations. This is necessary because it
     needs to treat the agent's code as data to transmit. `gawk' is not
     the ideal language for such a job. Lisp and Tcl are more suitable
     because they do not make a distinction between program code and
     data.

Independence
     After migration, the agent is not linked to its former home in any
     way. By reporting `Agent started', it waves "Goodbye" to its
     origin. The originator may choose to terminate or not.

The originating agent itself is started just like any other command-line
script, and reports the results on standard output.  By letting the name
of the original host migrate with the agent, the agent that migrates to
a host far away from its origin can report the result back home.
Having arrived at the end of the journey, the agent establishes a
connection and reports the results.  This is the reason for determining
the name of the host with `uname -n' and storing it in `MyOrigin' for
later use.  We may also set variables with the `-v' option from the
command line. This interactivity is only of importance in the context
of starting a mobile agent; therefore this `BEGIN' pattern and its
action do not take part in migration:

     BEGIN {
       if (ARGC != 2) {
         print "MOBAG - a simple mobile agent"
         print "CALL:\n    gawk -f mobag.awk mobag.awk"
         print "IN:\n    the name of this script as a command-line parameter"
         print "PARAM:\n    -v MyOrigin=myhost.com"
         print "OUT:\n    the result on stdout"
         print "JK 29.03.1998 01.04.1998"
         exit
       }
       if (MyOrigin == "") {
          "uname -n" | getline MyOrigin
          close("uname -n")
       }
     }

Since `gawk' cannot manipulate and transmit parts of the program
directly, the source code is read and stored in strings.  Therefore,
the program scans itself for the beginning and the ending of functions.
Each line in between is appended to the code string until the end of
the function has been reached. A special case is this part of the
program itself. It is not a function.  Placing a similar framework
around it causes it to be treated like a function. Notice that this
mechanism works for all the functions of the source code, but it cannot
guarantee that the order of the functions is preserved during migration:

     #ReadMySelf
     /^function /                     { FUNC = $2 }
     /^END/ || /^#ReadMySelf/         { FUNC = $1 }
     FUNC != ""                       { MOBFUN[FUNC] = MOBFUN[FUNC] RS $0 }
     (FUNC != "") && (/^}/ || /^#EndOfMySelf/) \
                                      { FUNC = "" }
     #EndOfMySelf

The web server code in *Note A Web Service with Interaction:
Interacting Service, was first developed as a site-independent core.
Likewise, the `gawk'-based mobile agent starts with an
agent-independent core, to which can be appended application-dependent
functions.  What follows is the only application-independent function
needed for the mobile agent:

     function migrate(Destination, MobCode, Label) {
       MOBVAR["Label"] = Label
       MOBVAR["Destination"] = Destination
       RS = ORS = "\r\n"
       HttpService = "/inet/tcp/0/" Destination
       for (i in MOBFUN)
          MobCode = (MobCode "\n" MOBFUN[i])
       MobCode = MobCode  "\n\nBEGIN {"
       for (i in MOBVAR)
          MobCode = (MobCode "\n  MOBVAR[\"" i "\"] = \"" MOBVAR[i] "\"")
       MobCode = MobCode "\n}\n"
       print "POST /cgi-bin/PostAgent.sh HTTP/1.0"  |& HttpService
       print "Content-length:", length(MobCode) ORS |& HttpService
       printf "%s", MobCode                         |& HttpService
       while ((HttpService |& getline) > 0)
          print $0
       close(HttpService)
     }

The `migrate' function prepares the aforementioned strings containing
the program code and transmits them to a server. A consequence of this
modular approach is that the `migrate' function takes some parameters
that aren't needed in this application, but that will be in future
ones. Its mandatory parameter `Destination' holds the name (or IP
address) of the server that the agent wants as a host for its code. The
optional parameter `MobCode' may contain some `gawk' code that is
inserted during migration in front of all other code.  The optional
parameter `Label' may contain a string that tells the agent what to do
in program execution after arrival at its new home site. One of the
serious obstacles in implementing a framework for mobile agents is that
it does not suffice to migrate the code. It is also necessary to
migrate the state of execution of the agent. In contrast to `Agent
Tcl', this program does not try to migrate the complete set of
variables. The following conventions are used:

   * Each variable in an agent program is local to the current host and
     does _not_ migrate.

   * The array `MOBFUN' shown above is an exception. It is handled by
     the function `migrate' and does migrate with the application.

   * The other exception is the array `MOBVAR'. Each variable that
     takes part in migration has to be an element of this array.
     `migrate' also takes care of this.

Now it's clear what happens to the `Label' parameter of the function
`migrate'. It is copied into `MOBVAR["Label"]' and travels alongside
the other data. Since travelling takes place via HTTP, records must be
separated with `"\r\n"' in `RS' and `ORS' as usual. The code assembly
for migration takes place in three steps:

   * Iterate over `MOBFUN' to collect all functions verbatim.

   * Prepare a `BEGIN' pattern and put assignments to mobile variables
     into the action part.

   * Transmission itself resembles GETURL: the header with the request
     and the `Content-length' is followed by the body. In case there is
     any reply over the network, it is read completely and echoed to
     standard output to avoid irritating the server.

The application-independent framework is now almost complete. What
follows is the `END' pattern that is executed  when the mobile agent has
finished reading its own code. First, it checks whether it is already
running on a remote host or not. In case initialization has not yet
taken place, it starts `MyInit'. Otherwise (later, on a remote host), it
starts `MyJob':

     END {
       if (ARGC != 2) exit    # stop when called with wrong parameters
       if (MyOrigin != "")    # is this the originating host?
         MyInit()             # if so, initialize the application
       else                   # we are on a host with migrated data
         MyJob()              # so we do our job
     }

All that's left to extend the framework into a complete application is
to write two application-specific functions: `MyInit' and `MyJob'. Keep
in mind that the former is executed once on the originating host, while
the latter is executed after each migration:

     function MyInit() {
       MOBVAR["MyOrigin"] = MyOrigin
       MOBVAR["Machines"] = "localhost/80 max/80 moritz/80 castor/80"
       split(MOBVAR["Machines"], Machines)           # which host is the first?
       migrate(Machines[1], "", "")                  # go to the first host
       while (("/inet/tcp/8080/0/0" |& getline) > 0) # wait for result
         print $0                                    # print result
       close("/inet/tcp/8080/0/0")
     }

As mentioned earlier, this agent takes the name of its origin
(`MyOrigin') with it. Then, it takes the name of its first destination
and goes there for further work. Notice that this name has the port
number of the web server appended to the name of the server, because
the function `migrate' needs it this way to create the `HttpService'
variable. Finally, it waits for the result to arrive.  The `MyJob'
function runs on the remote host:

     function MyJob() {
       # forget this host
       sub(MOBVAR["Destination"], "", MOBVAR["Machines"])
       MOBVAR["Result"]=MOBVAR["Result"] SUBSEP SUBSEP MOBVAR["Destination"] ":"
       while (("who" | getline) > 0)               # who is logged in?
         MOBVAR["Result"] = MOBVAR["Result"] SUBSEP $0
       close("who")
       if (index(MOBVAR["Machines"], "/") > 0) {   # any more machines to visit?
         split(MOBVAR["Machines"], Machines)       # which host is next?
         migrate(Machines[1], "", "")              # go there
       } else {                                    # no more machines
         gsub(SUBSEP, "\n", MOBVAR["Result"])      # send result to origin
         print MOBVAR["Result"] |& "/inet/tcp/0/" MOBVAR["MyOrigin"] "/8080"
         close("/inet/tcp/0/" MOBVAR["MyOrigin"] "/8080")
       }
     }

After migrating, the first thing to do in `MyJob' is to delete the name
of the current host from the list of hosts to visit. Now, it is time to
start the real work by appending the host's name to the result string,
and reading line by line who is logged in on this host.  A very
annoying circumstance is the fact that the elements of `MOBVAR' cannot
hold the newline character (`"\n"'). If they did, migration of this
string did not work because the string didn't obey the syntax rule for
a string in `gawk'.  `SUBSEP' is used as a temporary replacement.  If
the list of hosts to visit holds at least one more entry, the agent
migrates to that place to go on working there. Otherwise, we replace
the `SUBSEP's with a newline character in the resulting string, and
report it to the originating host, whose name is stored in
`MOBVAR["MyOrigin"]'.

---------- Footnotes ----------

(1) `http://www.research.ibm.com/massive/mobag.ps'


File: gawkinet.info,  Node: STOXPRED,  Next: PROTBASE,  Prev: MOBAGWHO,  Up: Some Applications and Techniques

3.9 STOXPRED: Stock Market Prediction As A Service
==================================================

     Far out in the uncharted backwaters of the unfashionable end of
     the Western Spiral arm of the Galaxy lies a small unregarded
     yellow sun.

     Orbiting this at a distance of roughly ninety-two million miles is
     an utterly insignificant little blue-green planet whose
     ape-descendent life forms are so amazingly primitive that they
     still think digital watches are a pretty neat idea.

     This planet has -- or rather had -- a problem, which was this:
     most of the people living on it were unhappy for pretty much of
     the time.  Many solutions were suggested for this problem, but
     most of these were largely concerned with the movements of small
     green pieces of paper, which is odd because it wasn't the small
     green pieces of paper that were unhappy.
     Douglas Adams, `The Hitch Hiker's Guide to the Galaxy'

Valuable services on the Internet are usually _not_ implemented as
mobile agents. There are much simpler ways of implementing services.
All Unix systems provide, for example, the `cron' service.  Unix system
users can write a list of tasks to be done each day, each week, twice a
day, or just once. The list is entered into a file named `crontab'.
For example, to distribute a newsletter on a daily basis this way, use
`cron' for calling a script each day early in the morning.

     # run at 8 am on weekdays, distribute the newsletter
     0 8 * * 1-5   $HOME/bin/daily.job >> $HOME/log/newsletter 2>&1

The script first looks for interesting information on the Internet,
assembles it in a nice form and sends the results via email to the
customers.

The following is an example of a primitive newsletter on stock market
prediction. It is a report which first tries to predict the change of
each share in the Dow Jones Industrial Index for the particular day.
Then it mentions some especially promising shares as well as some
shares which look remarkably bad on that day. The report ends with the
usual disclaimer which tells every child _not_ to try this at home and
hurt anybody.  

     Good morning Uncle Scrooge,

     This is your daily stock market report for Monday, October 16, 2000.
     Here are the predictions for today:

             AA      neutral
             GE      up
             JNJ     down
             MSFT    neutral
             ...
             UTX     up
             DD      down
             IBM     up
             MO      down
             WMT     up
             DIS     up
             INTC    up
             MRK     down
             XOM     down
             EK      down
             IP      down

     The most promising shares for today are these:

             INTC            http://biz.yahoo.com/n/i/intc.html

     The stock shares to avoid today are these:

             EK              http://biz.yahoo.com/n/e/ek.html
             IP              http://biz.yahoo.com/n/i/ip.html
             DD              http://biz.yahoo.com/n/d/dd.html
             ...

The script as a whole is rather long. In order to ease the pain of
studying other people's source code, we have broken the script up into
meaningful parts which are invoked one after the other.  The basic
structure of the script is as follows:

     BEGIN {
       Init()
       ReadQuotes()
       CleanUp()
       Prediction()
       Report()
       SendMail()
     }

The earlier parts store data into variables and arrays which are
subsequently used by later parts of the script. The `Init' function
first checks if the script is invoked correctly (without any
parameters).  If not, it informs the user of the correct usage. What
follows are preparations for the retrieval of the historical quote
data. The names of the 30 stock shares are stored in an array `name'
along with the current date in `day', `month', and `year'.

All users who are separated from the Internet by a firewall and have to
direct their Internet accesses to a proxy must supply the name of the
proxy to this script with the `-v Proxy=NAME' option. For most users,
the default proxy and port number should suffice.

     function Init() {
       if (ARGC != 1) {
         print "STOXPRED - daily stock share prediction"
         print "IN:\n    no parameters, nothing on stdin"
         print "PARAM:\n    -v Proxy=MyProxy -v ProxyPort=80"
         print "OUT:\n    commented predictions as email"
         print "JK 09.10.2000"
         exit
       }
       # Remember ticker symbols from Dow Jones Industrial Index
       StockCount = split("AA GE JNJ MSFT AXP GM JPM PG BA HD KO \
         SBC C HON MCD T CAT HWP MMM UTX DD IBM MO WMT DIS INTC \
         MRK XOM EK IP", name);
       # Remember the current date as the end of the time series
       day   = strftime("%d")
       month = strftime("%m")
       year  = strftime("%Y")
       if (Proxy     == "")  Proxy     = "chart.yahoo.com"
       if (ProxyPort ==  0)  ProxyPort = 80
       YahooData = "/inet/tcp/0/" Proxy "/" ProxyPort
     }

There are two really interesting parts in the script. One is the
function which reads the historical stock quotes from an Internet
server. The other is the one that does the actual prediction. In the
following function we see how the quotes are read from the Yahoo
server. The data which comes from the server is in CSV format
(comma-separated values):

     Date,Open,High,Low,Close,Volume
     9-Oct-00,22.75,22.75,21.375,22.375,7888500
     6-Oct-00,23.8125,24.9375,21.5625,22,10701100
     5-Oct-00,24.4375,24.625,23.125,23.50,5810300

Lines contain values of the same time instant, whereas columns are
separated by commas and contain the kind of data that is described in
the header (first) line. At first, `gawk' is instructed to separate
columns by commas (`FS = ","'). In the loop that follows, a connection
to the Yahoo server is first opened, then a download takes place, and
finally the connection is closed. All this happens once for each ticker
symbol. In the body of this loop, an Internet address is built up as a
string according to the rules of the Yahoo server. The starting and
ending date are chosen to be exactly the same, but one year apart in
the past. All the action is initiated within the `printf' command which
transmits the request for data to the Yahoo server.

In the inner loop, the server's data is first read and then scanned
line by line. Only lines which have six columns and the name of a month
in the first column contain relevant data. This data is stored in the
two-dimensional array `quote'; one dimension being time, the other
being the ticker symbol. During retrieval of the first stock's data,
the calendar names of the time instances are stored in the array `day'
because we need them later.

     function ReadQuotes() {
       # Retrieve historical data for each ticker symbol
       FS = ","
       for (stock = 1; stock <= StockCount; stock++) {
         URL = "http://chart.yahoo.com/table.csv?s=" name[stock] \
               "&a=" month "&b=" day   "&c=" year-1 \
               "&d=" month "&e=" day   "&f=" year \
               "g=d&q=q&y=0&z=" name[stock] "&x=.csv"
         printf("GET " URL " HTTP/1.0\r\n\r\n") |& YahooData
         while ((YahooData |& getline) > 0) {
           if (NF == 6 && $1 ~ /Jan|Feb|Mar|Apr|May|Jun|Jul|Aug|Sep|Oct|Nov|Dec/) {
             if (stock == 1)
               days[++daycount] = $1;
             quote[$1, stock] = $5
           }
         }
         close(YahooData)
       }
       FS = " "
     }

Now that we _have_ the data, it can be checked once again to make sure
that no individual stock is missing or invalid, and that all the stock
quotes are aligned correctly. Furthermore, we renumber the time
instances. The most recent day gets day number 1 and all other days get
consecutive numbers. All quotes are rounded toward the nearest whole
number in US Dollars.

     function CleanUp() {
       # clean up time series; eliminate incomplete data sets
       for (d = 1; d <= daycount; d++) {
         for (stock = 1; stock <= StockCount; stock++)
           if (! ((days[d], stock) in quote))
               stock = StockCount + 10
         if (stock > StockCount + 1)
             continue
         datacount++
         for (stock = 1; stock <= StockCount; stock++)
           data[datacount, stock] = int(0.5 + quote[days[d], stock])
       }
       delete quote
       delete days
     }

Now we have arrived at the second really interesting part of the whole
affair.  What we present here is a very primitive prediction algorithm:
_If a stock fell yesterday, assume it will also fall today; if it rose
yesterday, assume it will rise today_.  (Feel free to replace this
algorithm with a smarter one.) If a stock changed in the same direction
on two consecutive days, this is an indication which should be
highlighted.  Two-day advances are stored in `hot' and two-day declines
in `avoid'.

The rest of the function is a sanity check. It counts the number of
correct predictions in relation to the total number of predictions one
could have made in the year before.

     function Prediction() {
       # Predict each ticker symbol by prolonging yesterday's trend
       for (stock = 1; stock <= StockCount; stock++) {
         if         (data[1, stock] > data[2, stock]) {
           predict[stock] = "up"
         } else if  (data[1, stock] < data[2, stock]) {
           predict[stock] = "down"
         } else {
           predict[stock] = "neutral"
         }
         if ((data[1, stock] > data[2, stock]) && (data[2, stock] > data[3, stock]))
           hot[stock] = 1
         if ((data[1, stock] < data[2, stock]) && (data[2, stock] < data[3, stock]))
           avoid[stock] = 1
       }
       # Do a plausibility check: how many predictions proved correct?
       for (s = 1; s <= StockCount; s++) {
         for (d = 1; d <= datacount-2; d++) {
           if         (data[d+1, s] > data[d+2, s]) {
             UpCount++
           } else if  (data[d+1, s] < data[d+2, s]) {
             DownCount++
           } else {
             NeutralCount++
           }
           if (((data[d, s]  > data[d+1, s]) && (data[d+1, s]  > data[d+2, s])) ||
               ((data[d, s]  < data[d+1, s]) && (data[d+1, s]  < data[d+2, s])) ||
               ((data[d, s] == data[d+1, s]) && (data[d+1, s] == data[d+2, s])))
             CorrectCount++
         }
       }
     }

At this point the hard work has been done: the array `predict' contains
the predictions for all the ticker symbols. It is up to the function
`Report' to find some nice words to introduce the desired information.

     function Report() {
       # Generate report
       report =        "\nThis is your daily "
       report = report "stock market report for "strftime("%A, %B %d, %Y")".\n"
       report = report "Here are the predictions for today:\n\n"
       for (stock = 1; stock <= StockCount; stock++)
         report = report "\t" name[stock] "\t" predict[stock] "\n"
       for (stock in hot) {
         if (HotCount++ == 0)
           report = report "\nThe most promising shares for today are these:\n\n"
         report = report "\t" name[stock] "\t\thttp://biz.yahoo.com/n/" \
           tolower(substr(name[stock], 1, 1)) "/" tolower(name[stock]) ".html\n"
       }
       for (stock in avoid) {
         if (AvoidCount++ == 0)
           report = report "\nThe stock shares to avoid today are these:\n\n"
         report = report "\t" name[stock] "\t\thttp://biz.yahoo.com/n/" \
           tolower(substr(name[stock], 1, 1)) "/" tolower(name[stock]) ".html\n"
       }
       report = report "\nThis sums up to " HotCount+0 " winners and " AvoidCount+0
       report = report " losers. When using this kind\nof prediction scheme for"
       report = report " the 12 months which lie behind us,\nwe get " UpCount
       report = report " 'ups' and " DownCount " 'downs' and " NeutralCount
       report = report " 'neutrals'. Of all\nthese " UpCount+DownCount+NeutralCount
       report = report " predictions " CorrectCount " proved correct next day.\n"
       report = report "A success rate of "\
                  int(100*CorrectCount/(UpCount+DownCount+NeutralCount)) "%.\n"
       report = report "Random choice would have produced a 33% success rate.\n"
       report = report "Disclaimer: Like every other prediction of the stock\n"
       report = report "market, this report is, of course, complete nonsense.\n"
       report = report "If you are stupid enough to believe these predictions\n"
       report = report "you should visit a doctor who can treat your ailment."
     }

The function `SendMail' goes through the list of customers and opens a
pipe to the `mail' command for each of them. Each one receives an email
message with a proper subject heading and is addressed with his full
name.

     function SendMail() {
       # send report to customers
       customer["uncle.scrooge@ducktown.gov"] = "Uncle Scrooge"
       customer["more@utopia.org"           ] = "Sir Thomas More"
       customer["spinoza@denhaag.nl"        ] = "Baruch de Spinoza"
       customer["marx@highgate.uk"          ] = "Karl Marx"
       customer["keynes@the.long.run"       ] = "John Maynard Keynes"
       customer["bierce@devil.hell.org"     ] = "Ambrose Bierce"
       customer["laplace@paris.fr"          ] = "Pierre Simon de Laplace"
       for (c in customer) {
         MailPipe = "mail -s 'Daily Stock Prediction Newsletter'" c
         print "Good morning " customer[c] "," | MailPipe
         print report "\n.\n" | MailPipe
         close(MailPipe)
       }
     }

Be patient when running the script by hand.  Retrieving the data for
all the ticker symbols and sending the emails may take several minutes
to complete, depending upon network traffic and the speed of the
available Internet link.  The quality of the prediction algorithm is
likely to be disappointing.  Try to find a better one.  Should you find
one with a success rate of more than 50%, please tell us about it! It
is only for the sake of curiosity, of course. `:-)'


File: gawkinet.info,  Node: PROTBASE,  Prev: STOXPRED,  Up: Some Applications and Techniques

3.10 PROTBASE: Searching Through A Protein Database
===================================================

     Hoare's Law of Large Problems: Inside every large problem is a
     small    problem struggling to get out.

Yahoo's database of stock market data is just one among the many large
databases on the Internet. Another one is located at NCBI (National
Center for Biotechnology Information). Established in 1988 as a
national resource for molecular biology information, NCBI creates
public databases, conducts research in computational biology, develops
software tools for analyzing genome data, and disseminates biomedical
information. In this section, we look at one of NCBI's public services,
which is called BLAST (Basic Local Alignment Search Tool).

You probably know that the information necessary for reproducing living
cells is encoded in the genetic material of the cells. The genetic
material is a very long chain of four base nucleotides. It is the order
of appearance (the sequence) of nucleotides which contains the
information about the substance to be produced. Scientists in
biotechnology often find a specific fragment, determine the nucleotide
sequence, and need to know where the sequence at hand comes from. This
is where the large databases enter the game. At NCBI, databases store
the knowledge about which sequences have ever been found and where they
have been found.  When the scientist sends his sequence to the BLAST
service, the server looks for regions of genetic material in its
database which look the most similar to the delivered nucleotide
sequence. After a search time of some seconds or minutes the server
sends an answer to the scientist. In order to make access simple, NCBI
chose to offer their database service through popular Internet
protocols. There are four basic ways to use the so-called BLAST
services:

   * The easiest way to use BLAST is through the web. Users may simply
     point their browsers at the NCBI home page and link to the BLAST
     pages.  NCBI provides a stable URL that may be used to perform
     BLAST searches without interactive use of a web browser. This is
     what we will do later in this section.  A demonstration client and
     a `README' file demonstrate how to access this URL.

   * Currently, `blastcl3' is the standard network BLAST client.  You
     can download `blastcl3' from the anonymous FTP location.

   * BLAST 2.0 can be run locally as a full executable and can be used
     to run BLAST searches against private local databases, or
     downloaded copies of the NCBI databases. BLAST 2.0 executables may
     be found on the NCBI anonymous FTP server.

   * The NCBI BLAST Email server is the best option for people without
     convenient access to the web. A similarity search can be performed
     by sending a properly formatted mail message containing the
     nucleotide or protein query sequence to <blast@ncbi.nlm.nih.gov>.
     The query sequence is compared against the specified database
     using the BLAST algorithm and the results are returned in an email
     message. For more information on formulating email BLAST searches,
     you can send a message consisting of the word "HELP" to the same
     address, <blast@ncbi.nlm.nih.gov>.

Our starting point is the demonstration client mentioned in the first
option.  The `README' file that comes along with the client explains
the whole process in a nutshell. In the rest of this section, we first
show what such requests look like. Then we show how to use `gawk' to
implement a client in about 10 lines of code. Finally, we show how to
interpret the result returned from the service.

Sequences are expected to be represented in the standard IUB/IUPAC
amino acid and nucleic acid codes, with these exceptions:  lower-case
letters are accepted and are mapped into upper-case; a single hyphen or
dash can be used to represent a gap of indeterminate length; and in
amino acid sequences, `U' and `*' are acceptable letters (see below).
Before submitting a request, any numerical digits in the query sequence
should either be removed or replaced by appropriate letter codes (e.g.,
`N' for unknown nucleic acid residue or `X' for unknown amino acid
residue).  The nucleic acid codes supported are:

     A --> adenosine               M --> A C (amino)
     C --> cytidine                S --> G C (strong)
     G --> guanine                 W --> A T (weak)
     T --> thymidine               B --> G T C
     U --> uridine                 D --> G A T
     R --> G A (purine)            H --> A C T
     Y --> T C (pyrimidine)        V --> G C A
     K --> G T (keto)              N --> A G C T (any)
                                   -  gap of indeterminate length

Now you know the alphabet of nucleotide sequences. The last two lines
of the following example query show you such a sequence, which is
obviously made up only of elements of the alphabet just described.
Store this example query into a file named `protbase.request'. You are
now ready to send it to the server with the demonstration client.

     PROGRAM blastn
     DATALIB month
     EXPECT 0.75
     BEGIN
     >GAWK310 the gawking gene GNU AWK
     tgcttggctgaggagccataggacgagagcttcctggtgaagtgtgtttcttgaaatcat
     caccaccatggacagcaaa

The actual search request begins with the mandatory parameter `PROGRAM'
in the first column followed by the value `blastn' (the name of the
program) for searching nucleic acids.  The next line contains the
mandatory search parameter `DATALIB' with the value `month' for the
newest nucleic acid sequences.  The third line contains an optional
`EXPECT' parameter and the value desired for it. The fourth line
contains the mandatory `BEGIN' directive, followed by the query
sequence in FASTA/Pearson format.  Each line of information must be
less than 80 characters in length.

The "month" database contains all new or revised sequences released in
the last 30 days and is useful for searching against new sequences.
There are five different blast programs, `blastn' being the one that
compares a nucleotide  query  sequence  against a nucleotide sequence
database.

The last server directive that must appear in every request is the
`BEGIN' directive. The query sequence should immediately follow the
`BEGIN' directive and must appear in FASTA/Pearson format.  A sequence
in FASTA/Pearson format begins with a single-line description.  The
description line, which is required, is distinguished from the lines of
sequence data that follow it by having a greater-than (`>') symbol in
the first column.  For the purposes of the BLAST server, the text of
the description is arbitrary.

If you prefer to use a client written in `gawk', just store the
following 10 lines of code into a file named `protbase.awk' and use
this client instead. Invoke it with `gawk -f protbase.awk
protbase.request'.  Then wait a minute and watch the result coming in.
In order to replicate the demonstration client's behaviour as closely
as possible, this client does not use a proxy server. We could also
have extended the client program in *Note Retrieving Web Pages: GETURL,
to implement the client request from `protbase.awk' as a special case.

     { request = request "\n" $0 }

     END {
       BLASTService     = "/inet/tcp/0/www.ncbi.nlm.nih.gov/80"
       printf "POST /cgi-bin/BLAST/nph-blast_report HTTP/1.0\n" |& BLASTService
       printf "Content-Length: " length(request) "\n\n"         |& BLASTService
       printf request                                           |& BLASTService
       while ((BLASTService |& getline) > 0)
           print $0
       close(BLASTService)
     }

The demonstration client from NCBI is 214 lines long (written in C) and
it is not immediately obvious what it does. Our client is so short that
it _is_ obvious what it does. First it loops over all lines of the
query and stores the whole query into a variable. Then the script
establishes an Internet connection to the NCBI server and transmits the
query by framing it with a proper HTTP request. Finally it receives and
prints the complete result coming from the server.

Now, let us look at the result. It begins with an HTTP header, which you
can ignore. Then there are some comments about the query having been
filtered to avoid spuriously high scores. After this, there is a
reference to the paper that describes the software being used for
searching the data base. After a repitition of the original query's
description we find the list of significant alignments:

     Sequences producing significant alignments:                        (bits)  Value

     gb|AC021182.14|AC021182 Homo sapiens chromosome 7 clone RP11-733...    38  0.20
     gb|AC021056.12|AC021056 Homo sapiens chromosome 3 clone RP11-115...    38  0.20
     emb|AL160278.10|AL160278 Homo sapiens chromosome 9 clone RP11-57...    38  0.20
     emb|AL391139.11|AL391139 Homo sapiens chromosome X clone RP11-35...    38  0.20
     emb|AL365192.6|AL365192 Homo sapiens chromosome 6 clone RP3-421H...    38  0.20
     emb|AL138812.9|AL138812 Homo sapiens chromosome 11 clone RP1-276...    38  0.20
     gb|AC073881.3|AC073881 Homo sapiens chromosome 15 clone CTD-2169...    38  0.20

This means that the query sequence was found in seven human chromosomes.
But the value 0.20 (20%) means that the probability of an accidental
match is rather high (20%) in all cases and should be taken into
account.  You may wonder what the first column means. It is a key to
the specific database in which this occurence was found.  The unique
sequence identifiers reported in the search results can be used as
sequence retrieval keys via the NCBI server. The syntax of sequence
header lines used by the NCBI BLAST server depends on the database from
which each sequence was obtained.  The table below lists the
identifiers for the databases from which the sequences were derived.

     Database Name                     Identifier Syntax
     ============================      ========================
     GenBank                           gb|accession|locus
     EMBL Data Library                 emb|accession|locus
     DDBJ, DNA Database of Japan       dbj|accession|locus
     NBRF PIR                          pir||entry
     Protein Research Foundation       prf||name
     SWISS-PROT                        sp|accession|entry name
     Brookhaven Protein Data Bank      pdb|entry|chain
     Kabat's Sequences of Immuno...    gnl|kabat|identifier
     Patents                           pat|country|number
     GenInfo Backbone Id               bbs|number

For example, an identifier might be `gb|AC021182.14|AC021182', where the
`gb' tag indicates that the identifier refers to a GenBank sequence,
`AC021182.14' is its GenBank ACCESSION, and `AC021182' is the GenBank
LOCUS.  The identifier contains no spaces, so that a space indicates
the end of the identifier.

Let us continue in the result listing. Each of the seven alignments
mentioned above is subsequently described in detail. We will have a
closer look at the first of them.

     >gb|AC021182.14|AC021182 Homo sapiens chromosome 7 clone RP11-733N23, WORKING DRAFT SEQUENCE, 4
                  unordered pieces
               Length = 176383

      Score = 38.2 bits (19), Expect = 0.20
      Identities = 19/19 (100%)
      Strand = Plus / Plus

     Query: 35    tggtgaagtgtgtttcttg 53
                  |||||||||||||||||||
     Sbjct: 69786 tggtgaagtgtgtttcttg 69804

This alignment was located on the human chromosome 7. The fragment on
which part of the query was found had a total length of 176383. Only 19
of the nucleotides matched and the matching sequence ran from character
35 to 53 in the query sequence and from 69786 to 69804 in the fragment
on chromosome 7.  If you are still reading at this point, you are
probably interested in finding out more about Computational Biology and
you might appreciate the following hints.

  1. There is a book called `Introduction to Computational Biology' by
     Michael S. Waterman, which is worth reading if you are seriously
     interested. You can find a good book review on the Internet.

  2. While Waterman's book can explain to you the algorithms employed
     internally in the database search engines, most practicioners
     prefer to approach the subject differently. The applied side of
     Computational Biology is called Bioinformatics, and emphasizes the
     tools available for day-to-day work as well as how to actually
     _use_ them. One of the very few affordable books on Bioinformatics
     is `Developing Bioinformatics Computer Skills'.

  3. The sequences _gawk_ and _gnuawk_ are in widespread use in the
     genetic material of virtually every earthly living being. Let us
     take this as a clear indication that the divine creator has
     intended `gawk' to prevail over other scripting languages such as
     `perl', `tcl', or `python' which are not even proper sequences.
     (:-)


File: gawkinet.info,  Node: Links,  Next: GNU Free Documentation License,  Prev: Some Applications and Techniques,  Up: Top

4 Related Links
***************

This section lists the URLs for various items discussed in this major
node.  They are presented in the order in which they appear.

`Internet Programming with Python'
     `http://www.fsbassociates.com/books/python.htm'

`Advanced Perl Programming'
     `http://www.oreilly.com/catalog/advperl'

`Web Client Programming with Perl'
     `http://www.oreilly.com/catalog/webclient'

Richard Stevens's home page and book
     `http://www.kohala.com/~rstevens'

The SPAK home page
     `http://www.userfriendly.net/linux/RPM/contrib/libc6/i386/spak-0.6b-1.i386.html'

Volume III of `Internetworking with TCP/IP', by Comer and Stevens
     `http://www.cs.purdue.edu/homes/dec/tcpip3s.cont.html'

XBM Graphics File Format
     `http://www.wotsit.org/download.asp?f=xbm'

GNUPlot
     `http://www.cs.dartmouth.edu/gnuplot_info.html'

Mark Humphrys' Eliza page
     `http://www.compapp.dcu.ie/~humphrys/eliza.html'

Yahoo! Eliza Information
     `http://dir.yahoo.com/Recreation/Games/Computer_Games/Internet_Games/Web_Games/Artificial_Intelligence'

Java versions of Eliza
     `http://www.tjhsst.edu/Psych/ch1/eliza.html'

Java versions of Eliza with source code
     `http://home.adelphia.net/~lifeisgood/eliza/eliza.htm'

Eliza Programs with Explanations
     `http://chayden.net/chayden/eliza/Eliza.shtml'

Loebner Contest
     `http://acm.org/~loebner/loebner-prize.htmlx'

Tck/Tk Information
     `http://www.scriptics.com/'

Intel 80x86 Processors
     `http://developer.intel.com/design/platform/embedpc/what_is.htm'

AMD Elan Processors
     `http://www.amd.com/products/epd/processors/4.32bitcont/32bitcont/index.html'

XINU
     `http://willow.canberra.edu.au/~chrisc/xinu.html'

GNU/Linux
     `http://uclinux.lineo.com/'

Embedded PCs
     `http://dir.yahoo.com/Business_and_Economy/Business_to_Business/Computers/Hardware/Embedded_Control/'

MiniSQL
     `http://www.hughes.com.au/library/'

Market Share Surveys
     `http://www.netcraft.com/survey'

`Numerical Recipes in C: The Art of Scientific Computing'
     `http://www.nr.com'

VRML
     `http://www.vrml.org'

The VRML FAQ
     `http://www.vrml.org/technicalinfo/specifications/specifications.htm#FAQ'

The UMBC Agent Web
     `http://www.cs.umbc.edu/agents'

Apache Web Server
     `http://www.apache.org'

National Center for Biotechnology Information (NCBI)
     `http://www.ncbi.nlm.nih.gov'

Basic Local Alignment Search Tool (BLAST)
     `http://www.ncbi.nlm.nih.gov/BLAST/blast_overview.html'

NCBI Home Page
     `http://www.ncbi.nlm.nih.gov'

BLAST Pages
     `http://www.ncbi.nlm.nih.gov/BLAST'

BLAST Demonstration Client
     `ftp://ncbi.nlm.nih.gov/blast/blasturl/'

BLAST anonymous FTP location
     `ftp://ncbi.nlm.nih.gov/blast/network/netblast/'

BLAST 2.0 Executables
     `ftp://ncbi.nlm.nih.gov/blast/executables/'

IUB/IUPAC Amino Acid and Nucleic Acid Codes
     `http://www.uthscsa.edu/geninfo/blastmail.html#item6'

FASTA/Pearson Format
     `http://www.ncbi.nlm.nih.gov/BLAST/fasta.html'

Fasta/Pearson Sequence in Java
     `http://www.kazusa.or.jp/java/codon_table_java/'

Book Review of `Introduction to Computational Biology'
     `http://www.acm.org/crossroads/xrds5-1/introcb.html'

`Developing Bioinformatics Computer Skills'
     `http://www.oreilly.com/catalog/bioskills/'



File: gawkinet.info,  Node: GNU Free Documentation License,  Next: Index,  Prev: Links,  Up: Top

GNU Free Documentation License
******************************

                      Version 1.2, November 2002
     Copyright (C) 2000,2001,2002 Free Software Foundation, Inc.
     59 Temple Place, Suite 330, Boston, MA  02111-1307, USA

     Everyone is permitted to copy and distribute verbatim copies
     of this license document, but changing it is not allowed.

  0. PREAMBLE

     The purpose of this License is to make a manual, textbook, or other
     functional and useful document "free" in the sense of freedom: to
     assure everyone the effective freedom to copy and redistribute it,
     with or without modifying it, either commercially or
     noncommercially.  Secondarily, this License preserves for the
     author and publisher a way to get credit for their work, while not
     being considered responsible for modifications made by others.

     This License is a kind of "copyleft", which means that derivative
     works of the document must themselves be free in the same sense.
     It complements the GNU General Public License, which is a copyleft
     license designed for free software.

     We have designed this License in order to use it for manuals for
     free software, because free software needs free documentation: a
     free program should come with manuals providing the same freedoms
     that the software does.  But this License is not limited to
     software manuals; it can be used for any textual work, regardless
     of subject matter or whether it is published as a printed book.
     We recommend this License principally for works whose purpose is
     instruction or reference.

  1. APPLICABILITY AND DEFINITIONS

     This License applies to any manual or other work, in any medium,
     that contains a notice placed by the copyright holder saying it
     can be distributed under the terms of this License.  Such a notice
     grants a world-wide, royalty-free license, unlimited in duration,
     to use that work under the conditions stated herein.  The
     "Document", below, refers to any such manual or work.  Any member
     of the public is a licensee, and is addressed as "you".  You
     accept the license if you copy, modify or distribute the work in a
     way requiring permission under copyright law.

     A "Modified Version" of the Document means any work containing the
     Document or a portion of it, either copied verbatim, or with
     modifications and/or translated into another language.

     A "Secondary Section" is a named appendix or a front-matter section
     of the Document that deals exclusively with the relationship of the
     publishers or authors of the Document to the Document's overall
     subject (or to related matters) and contains nothing that could
     fall directly within that overall subject.  (Thus, if the Document
     is in part a textbook of mathematics, a Secondary Section may not
     explain any mathematics.)  The relationship could be a matter of
     historical connection with the subject or with related matters, or
     of legal, commercial, philosophical, ethical or political position
     regarding them.

     The "Invariant Sections" are certain Secondary Sections whose
     titles are designated, as being those of Invariant Sections, in
     the notice that says that the Document is released under this
     License.  If a section does not fit the above definition of
     Secondary then it is not allowed to be designated as Invariant.
     The Document may contain zero Invariant Sections.  If the Document
     does not identify any Invariant Sections then there are none.

     The "Cover Texts" are certain short passages of text that are
     listed, as Front-Cover Texts or Back-Cover Texts, in the notice
     that says that the Document is released under this License.  A
     Front-Cover Text may be at most 5 words, and a Back-Cover Text may
     be at most 25 words.

     A "Transparent" copy of the Document means a machine-readable copy,
     represented in a format whose specification is available to the
     general public, that is suitable for revising the document
     straightforwardly with generic text editors or (for images
     composed of pixels) generic paint programs or (for drawings) some
     widely available drawing editor, and that is suitable for input to
     text formatters or for automatic translation to a variety of
     formats suitable for input to text formatters.  A copy made in an
     otherwise Transparent file format whose markup, or absence of
     markup, has been arranged to thwart or discourage subsequent
     modification by readers is not Transparent.  An image format is
     not Transparent if used for any substantial amount of text.  A
     copy that is not "Transparent" is called "Opaque".

     Examples of suitable formats for Transparent copies include plain
     ASCII without markup, Texinfo input format, LaTeX input format,
     SGML or XML using a publicly available DTD, and
     standard-conforming simple HTML, PostScript or PDF designed for
     human modification.  Examples of transparent image formats include
     PNG, XCF and JPG.  Opaque formats include proprietary formats that
     can be read and edited only by proprietary word processors, SGML or
     XML for which the DTD and/or processing tools are not generally
     available, and the machine-generated HTML, PostScript or PDF
     produced by some word processors for output purposes only.

     The "Title Page" means, for a printed book, the title page itself,
     plus such following pages as are needed to hold, legibly, the
     material this License requires to appear in the title page.  For
     works in formats which do not have any title page as such, "Title
     Page" means the text near the most prominent appearance of the
     work's title, preceding the beginning of the body of the text.

     A section "Entitled XYZ" means a named subunit of the Document
     whose title either is precisely XYZ or contains XYZ in parentheses
     following text that translates XYZ in another language.  (Here XYZ
     stands for a specific section name mentioned below, such as
     "Acknowledgements", "Dedications", "Endorsements", or "History".)
     To "Preserve the Title" of such a section when you modify the
     Document means that it remains a section "Entitled XYZ" according
     to this definition.

     The Document may include Warranty Disclaimers next to the notice
     which states that this License applies to the Document.  These
     Warranty Disclaimers are considered to be included by reference in
     this License, but only as regards disclaiming warranties: any other
     implication that these Warranty Disclaimers may have is void and
     has no effect on the meaning of this License.

  2. VERBATIM COPYING

     You may copy and distribute the Document in any medium, either
     commercially or noncommercially, provided that this License, the
     copyright notices, and the license notice saying this License
     applies to the Document are reproduced in all copies, and that you
     add no other conditions whatsoever to those of this License.  You
     may not use technical measures to obstruct or control the reading
     or further copying of the copies you make or distribute.  However,
     you may accept compensation in exchange for copies.  If you
     distribute a large enough number of copies you must also follow
     the conditions in section 3.

     You may also lend copies, under the same conditions stated above,
     and you may publicly display copies.

  3. COPYING IN QUANTITY

     If you publish printed copies (or copies in media that commonly
     have printed covers) of the Document, numbering more than 100, and
     the Document's license notice requires Cover Texts, you must
     enclose the copies in covers that carry, clearly and legibly, all
     these Cover Texts: Front-Cover Texts on the front cover, and
     Back-Cover Texts on the back cover.  Both covers must also clearly
     and legibly identify you as the publisher of these copies.  The
     front cover must present the full title with all words of the
     title equally prominent and visible.  You may add other material
     on the covers in addition.  Copying with changes limited to the
     covers, as long as they preserve the title of the Document and
     satisfy these conditions, can be treated as verbatim copying in
     other respects.

     If the required texts for either cover are too voluminous to fit
     legibly, you should put the first ones listed (as many as fit
     reasonably) on the actual cover, and continue the rest onto
     adjacent pages.

     If you publish or distribute Opaque copies of the Document
     numbering more than 100, you must either include a
     machine-readable Transparent copy along with each Opaque copy, or
     state in or with each Opaque copy a computer-network location from
     which the general network-using public has access to download
     using public-standard network protocols a complete Transparent
     copy of the Document, free of added material.  If you use the
     latter option, you must take reasonably prudent steps, when you
     begin distribution of Opaque copies in quantity, to ensure that
     this Transparent copy will remain thus accessible at the stated
     location until at least one year after the last time you
     distribute an Opaque copy (directly or through your agents or
     retailers) of that edition to the public.

     It is requested, but not required, that you contact the authors of
     the Document well before redistributing any large number of
     copies, to give them a chance to provide you with an updated
     version of the Document.

  4. MODIFICATIONS

     You may copy and distribute a Modified Version of the Document
     under the conditions of sections 2 and 3 above, provided that you
     release the Modified Version under precisely this License, with
     the Modified Version filling the role of the Document, thus
     licensing distribution and modification of the Modified Version to
     whoever possesses a copy of it.  In addition, you must do these
     things in the Modified Version:

       A. Use in the Title Page (and on the covers, if any) a title
          distinct from that of the Document, and from those of
          previous versions (which should, if there were any, be listed
          in the History section of the Document).  You may use the
          same title as a previous version if the original publisher of
          that version gives permission.

       B. List on the Title Page, as authors, one or more persons or
          entities responsible for authorship of the modifications in
          the Modified Version, together with at least five of the
          principal authors of the Document (all of its principal
          authors, if it has fewer than five), unless they release you
          from this requirement.

       C. State on the Title page the name of the publisher of the
          Modified Version, as the publisher.

       D. Preserve all the copyright notices of the Document.

       E. Add an appropriate copyright notice for your modifications
          adjacent to the other copyright notices.

       F. Include, immediately after the copyright notices, a license
          notice giving the public permission to use the Modified
          Version under the terms of this License, in the form shown in
          the Addendum below.

       G. Preserve in that license notice the full lists of Invariant
          Sections and required Cover Texts given in the Document's
          license notice.

       H. Include an unaltered copy of this License.

       I. Preserve the section Entitled "History", Preserve its Title,
          and add to it an item stating at least the title, year, new
          authors, and publisher of the Modified Version as given on
          the Title Page.  If there is no section Entitled "History" in
          the Document, create one stating the title, year, authors,
          and publisher of the Document as given on its Title Page,
          then add an item describing the Modified Version as stated in
          the previous sentence.

       J. Preserve the network location, if any, given in the Document
          for public access to a Transparent copy of the Document, and
          likewise the network locations given in the Document for
          previous versions it was based on.  These may be placed in
          the "History" section.  You may omit a network location for a
          work that was published at least four years before the
          Document itself, or if the original publisher of the version
          it refers to gives permission.

       K. For any section Entitled "Acknowledgements" or "Dedications",
          Preserve the Title of the section, and preserve in the
          section all the substance and tone of each of the contributor
          acknowledgements and/or dedications given therein.

       L. Preserve all the Invariant Sections of the Document,
          unaltered in their text and in their titles.  Section numbers
          or the equivalent are not considered part of the section
          titles.

       M. Delete any section Entitled "Endorsements".  Such a section
          may not be included in the Modified Version.

       N. Do not retitle any existing section to be Entitled
          "Endorsements" or to conflict in title with any Invariant
          Section.

       O. Preserve any Warranty Disclaimers.

     If the Modified Version includes new front-matter sections or
     appendices that qualify as Secondary Sections and contain no
     material copied from the Document, you may at your option
     designate some or all of these sections as invariant.  To do this,
     add their titles to the list of Invariant Sections in the Modified
     Version's license notice.  These titles must be distinct from any
     other section titles.

     You may add a section Entitled "Endorsements", provided it contains
     nothing but endorsements of your Modified Version by various
     parties--for example, statements of peer review or that the text
     has been approved by an organization as the authoritative
     definition of a standard.

     You may add a passage of up to five words as a Front-Cover Text,
     and a passage of up to 25 words as a Back-Cover Text, to the end
     of the list of Cover Texts in the Modified Version.  Only one
     passage of Front-Cover Text and one of Back-Cover Text may be
     added by (or through arrangements made by) any one entity.  If the
     Document already includes a cover text for the same cover,
     previously added by you or by arrangement made by the same entity
     you are acting on behalf of, you may not add another; but you may
     replace the old one, on explicit permission from the previous
     publisher that added the old one.

     The author(s) and publisher(s) of the Document do not by this
     License give permission to use their names for publicity for or to
     assert or imply endorsement of any Modified Version.

  5. COMBINING DOCUMENTS

     You may combine the Document with other documents released under
     this License, under the terms defined in section 4 above for
     modified versions, provided that you include in the combination
     all of the Invariant Sections of all of the original documents,
     unmodified, and list them all as Invariant Sections of your
     combined work in its license notice, and that you preserve all
     their Warranty Disclaimers.

     The combined work need only contain one copy of this License, and
     multiple identical Invariant Sections may be replaced with a single
     copy.  If there are multiple Invariant Sections with the same name
     but different contents, make the title of each such section unique
     by adding at the end of it, in parentheses, the name of the
     original author or publisher of that section if known, or else a
     unique number.  Make the same adjustment to the section titles in
     the list of Invariant Sections in the license notice of the
     combined work.

     In the combination, you must combine any sections Entitled
     "History" in the various original documents, forming one section
     Entitled "History"; likewise combine any sections Entitled
     "Acknowledgements", and any sections Entitled "Dedications".  You
     must delete all sections Entitled "Endorsements."

  6. COLLECTIONS OF DOCUMENTS

     You may make a collection consisting of the Document and other
     documents released under this License, and replace the individual
     copies of this License in the various documents with a single copy
     that is included in the collection, provided that you follow the
     rules of this License for verbatim copying of each of the
     documents in all other respects.

     You may extract a single document from such a collection, and
     distribute it individually under this License, provided you insert
     a copy of this License into the extracted document, and follow
     this License in all other respects regarding verbatim copying of
     that document.

  7. AGGREGATION WITH INDEPENDENT WORKS

     A compilation of the Document or its derivatives with other
     separate and independent documents or works, in or on a volume of
     a storage or distribution medium, is called an "aggregate" if the
     copyright resulting from the compilation is not used to limit the
     legal rights of the compilation's users beyond what the individual
     works permit.  When the Document is included an aggregate, this
     License does not apply to the other works in the aggregate which
     are not themselves derivative works of the Document.

     If the Cover Text requirement of section 3 is applicable to these
     copies of the Document, then if the Document is less than one half
     of the entire aggregate, the Document's Cover Texts may be placed
     on covers that bracket the Document within the aggregate, or the
     electronic equivalent of covers if the Document is in electronic
     form.  Otherwise they must appear on printed covers that bracket
     the whole aggregate.

  8. TRANSLATION

     Translation is considered a kind of modification, so you may
     distribute translations of the Document under the terms of section
     4.  Replacing Invariant Sections with translations requires special
     permission from their copyright holders, but you may include
     translations of some or all Invariant Sections in addition to the
     original versions of these Invariant Sections.  You may include a
     translation of this License, and all the license notices in the
     Document, and any Warrany Disclaimers, provided that you also
     include the original English version of this License and the
     original versions of those notices and disclaimers.  In case of a
     disagreement between the translation and the original version of
     this License or a notice or disclaimer, the original version will
     prevail.

     If a section in the Document is Entitled "Acknowledgements",
     "Dedications", or "History", the requirement (section 4) to
     Preserve its Title (section 1) will typically require changing the
     actual title.

  9. TERMINATION

     You may not copy, modify, sublicense, or distribute the Document
     except as expressly provided for under this License.  Any other
     attempt to copy, modify, sublicense or distribute the Document is
     void, and will automatically terminate your rights under this
     License.  However, parties who have received copies, or rights,
     from you under this License will not have their licenses
     terminated so long as such parties remain in full compliance.

 10. FUTURE REVISIONS OF THIS LICENSE

     The Free Software Foundation may publish new, revised versions of
     the GNU Free Documentation License from time to time.  Such new
     versions will be similar in spirit to the present version, but may
     differ in detail to address new problems or concerns.  See
     `http://www.gnu.org/copyleft/'.

     Each version of the License is given a distinguishing version
     number.  If the Document specifies that a particular numbered
     version of this License "or any later version" applies to it, you
     have the option of following the terms and conditions either of
     that specified version or of any later version that has been
     published (not as a draft) by the Free Software Foundation.  If
     the Document does not specify a version number of this License,
     you may choose any version ever published (not as a draft) by the
     Free Software Foundation.

ADDENDUM: How to use this License for your documents
====================================================

To use this License in a document you have written, include a copy of
the License in the document and put the following copyright and license
notices just after the title page:

       Copyright (C)  YEAR  YOUR NAME.
       Permission is granted to copy, distribute and/or modify this document
       under the terms of the GNU Free Documentation License, Version 1.2
       or any later version published by the Free Software Foundation;
       with no Invariant Sections, no Front-Cover Texts, and no Back-Cover Texts.
       A copy of the license is included in the section entitled ``GNU
       Free Documentation License''.

If you have Invariant Sections, Front-Cover Texts and Back-Cover Texts,
replace the "with...Texts." line with this:

         with the Invariant Sections being LIST THEIR TITLES, with
         the Front-Cover Texts being LIST, and with the Back-Cover Texts
         being LIST.

If you have Invariant Sections without Cover Texts, or some other
combination of the three, merge those two alternatives to suit the
situation.

If your document contains nontrivial examples of program code, we
recommend releasing these examples in parallel under your choice of
free software license, such as the GNU General Public License, to
permit their use in free software.


File: gawkinet.info,  Node: Index,  Prev: GNU Free Documentation License,  Up: Top

Index
*****

* Menu:

* /inet/ files (gawk):                   Gawk Special Files. (line  490)
* /inet/raw special files (gawk):        File /inet/raw.     (line  712)
* /inet/tcp special files (gawk):        File /inet/tcp.     (line  647)
* /inet/udp special files (gawk):        File /inet/udp.     (line  679)
* advanced features, network connections: Troubleshooting.   (line  834)
* agent <1>:                             MOBAGWHO.           (line 2766)
* agent:                                 Challenges.         (line 1887)
* AI:                                    Challenges.         (line 1887)
* apache <1>:                            MOBAGWHO.           (line 2802)
* apache:                                WEBGRAB.            (line 2372)
* Bioinformatics:                        PROTBASE.           (line 3590)
* BLAST, Basic Local Alignment Search Tool: PROTBASE.        (line 3369)
* blocking:                              Making Connections. (line  383)
* Boutell, Thomas:                       STATIST.            (line 2396)
* CGI (Common Gateway Interface):        MOBAGWHO.           (line 2802)
* CGI (Common Gateway Interface), dynamic web pages and: Web page.
                                                             (line 1130)
* CGI (Common Gateway Interface), library: CGI Lib.          (line 1418)
* clients:                               Making Connections. (line  369)
* Clinton, Bill:                         Challenges.         (line 1870)
* Common Gateway Interface, See CGI:     Web page.           (line 1130)
* Computational Biology:                 PROTBASE.           (line 3590)
* contest:                               Challenges.         (line 1817)
* cron utility:                          STOXPRED.           (line 3068)
* CSV format:                            STOXPRED.           (line 3173)
* dark corner, RAW protocol:             File /inet/raw.     (line  719)
* Dow Jones Industrial Index:            STOXPRED.           (line 3089)
* ELIZA program:                         Simple Server.      (line 1606)
* email:                                 Email.              (line 1045)
* FASTA/Pearson format:                  PROTBASE.           (line 3465)
* FDL (Free Documentation License):      GNU Free Documentation License.
                                                             (line 3742)
* filenames, for network access:         Gawk Special Files. (line  485)
* files, /inet/ (gawk):                  Gawk Special Files. (line  490)
* files, /inet/raw (gawk):               File /inet/raw.     (line  712)
* files, /inet/tcp (gawk):               File /inet/tcp.     (line  647)
* files, /inet/udp (gawk):               File /inet/udp.     (line  679)
* finger utility:                        Setting Up.         (line  981)
* Free Documentation License (FDL):      GNU Free Documentation License.
                                                             (line 3742)
* FTP (File Transfer Protocol):          Basic Protocols.    (line  316)
* gawk, networking:                      Using Networking.   (line  414)
* gawk, networking, connections <1>:     TCP Connecting.     (line  781)
* gawk, networking, connections:         Special File Fields.
                                                             (line  549)
* gawk, networking, filenames:           Gawk Special Files. (line  485)
* gawk, networking, See Also email:      Email.              (line 1040)
* gawk, networking, service, establishing: Setting Up.       (line  965)
* gawk, networking, troubleshooting:     Caveats.            (line 1791)
* gawk, web and, See web service:        Interacting Service.
                                                             (line 1214)
* getline command:                       TCP Connecting.     (line  786)
* GETURL program:                        GETURL.             (line 2050)
* GIF image format <1>:                  STATIST.            (line 2396)
* GIF image format:                      Web page.           (line 1130)
* GNU Free Documentation License:        GNU Free Documentation License.
                                                             (line 3742)
* GNU/Linux <1>:                         REMCONF.            (line 2107)
* GNU/Linux <2>:                         Interacting.        (line  931)
* GNU/Linux:                             Troubleshooting.    (line  882)
* GNUPlot utility <1>:                   STATIST.            (line 2396)
* GNUPlot utility:                       Interacting Service.
                                                             (line 1396)
* Hoare, C.A.R. <1>:                     PROTBASE.           (line 3369)
* Hoare, C.A.R.:                         MOBAGWHO.           (line 2766)
* hostname field:                        Special File Fields.
                                                             (line  529)
* HTML (Hypertext Markup Language):      Web page.           (line 1114)
* HTTP (Hypertext Transfer Protocol) <1>: Web page.          (line 1090)
* HTTP (Hypertext Transfer Protocol):    Basic Protocols.    (line  316)
* HTTP (Hypertext Transfer Protocol), record separators and: Web page.
                                                             (line 1114)
* HTTP server, core logic:               Interacting Service.
                                                             (line 1214)
* Humphrys, Mark:                        Simple Server.      (line 1774)
* Hypertext Markup Language (HTML):      Web page.           (line 1114)
* Hypertext Transfer Protocol, See HTTP: Web page.           (line 1090)
* image format:                          STATIST.            (line 2396)
* images, in web pages:                  Interacting Service.
                                                             (line 1396)
* images, retrieving over networks:      Web page.           (line 1130)
* input/output, two-way, See Also gawk, networking: Gawk Special Files.
                                                             (line  475)
* Internet, See networks:                Interacting.        (line  952)
* JavaScript:                            STATIST.            (line 2446)
* Linux <1>:                             REMCONF.            (line 2107)
* Linux <2>:                             Interacting.        (line  931)
* Linux:                                 Troubleshooting.    (line  882)
* Lisp:                                  MOBAGWHO.           (line 2858)
* localport field:                       Gawk Special Files. (line  490)
* Loebner, Hugh:                         Challenges.         (line 1817)
* Loui, Ronald:                          Challenges.         (line 1887)
* MAZE:                                  MAZE.               (line 2634)
* Microsoft Windows:                     WEBGRAB.            (line 2343)
* Microsoft Windows, networking:         Troubleshooting.    (line  882)
* Microsoft Windows, networking, ports:  Setting Up.         (line  996)
* MiniSQL:                               REMCONF.            (line 2212)
* MOBAGWHO program:                      MOBAGWHO.           (line 2766)
* NCBI, National Center for Biotechnology Information: PROTBASE.
                                                             (line 3369)
* networks, gawk and:                    Using Networking.   (line  414)
* networks, gawk and, connections <1>:   TCP Connecting.     (line  781)
* networks, gawk and, connections:       Special File Fields.
                                                             (line  549)
* networks, gawk and, filenames:         Gawk Special Files. (line  485)
* networks, gawk and, See Also email:    Email.              (line 1040)
* networks, gawk and, service, establishing: Setting Up.     (line  965)
* networks, gawk and, troubleshooting:   Caveats.            (line 1791)
* networks, ports, reserved:             Setting Up.         (line  996)
* networks, ports, specifying:           Special File Fields.
                                                             (line  518)
* networks, See Also web pages:          PANIC.              (line 2008)
* Numerical Recipes:                     STATIST.            (line 2414)
* ORS variable, HTTP and:                Web page.           (line 1114)
* ORS variable, POP and:                 Email.              (line 1070)
* PANIC program:                         PANIC.              (line 2008)
* Perl:                                  Using Networking.   (line  422)
* Perl, gawk networking and:             Using Networking.   (line  432)
* Perlis, Alan:                          MAZE.               (line 2634)
* pipes, networking and:                 TCP Connecting.     (line  805)
* PNG image format <1>:                  STATIST.            (line 2396)
* PNG image format:                      Web page.           (line 1130)
* POP (Post Office Protocol):            Email.              (line 1040)
* Post Office Protocol (POP):            Email.              (line 1040)
* PostScript:                            STATIST.            (line 2528)
* PROLOG:                                Challenges.         (line 1887)
* PROTBASE:                              PROTBASE.           (line 3369)
* protocol field:                        Special File Fields.
                                                             (line  511)
* PS image format:                       STATIST.            (line 2396)
* Python:                                Using Networking.   (line  422)
* Python, gawk networking and:           Using Networking.   (line  432)
* RAW protocol:                          File /inet/raw.     (line  712)
* record separators, HTTP and:           Web page.           (line 1114)
* record separators, POP and:            Email.              (line 1070)
* REMCONF program:                       REMCONF.            (line 2107)
* remoteport field:                      Gawk Special Files. (line  490)
* robot <1>:                             WEBGRAB.            (line 2306)
* robot:                                 Challenges.         (line 1896)
* RS variable, HTTP and:                 Web page.           (line 1114)
* RS variable, POP and:                  Email.              (line 1070)
* servers <1>:                           Setting Up.         (line  981)
* servers:                               Making Connections. (line  362)
* servers, as hosts:                     Special File Fields.
                                                             (line  529)
* servers, HTTP:                         Interacting Service.
                                                             (line 1214)
* servers, web:                          Simple Server.      (line 1601)
* Simple Mail Transfer Protocol (SMTP):  Email.              (line 1040)
* SMTP (Simple Mail Transfer Protocol) <1>: Email.           (line 1040)
* SMTP (Simple Mail Transfer Protocol):  Basic Protocols.    (line  316)
* SPAK utility:                          File /inet/raw.     (line  727)
* STATIST program:                       STATIST.            (line 2396)
* STOXPRED program:                      STOXPRED.           (line 3051)
* synchronous communications:            Making Connections. (line  383)
* Tcl/Tk:                                Using Networking.   (line  422)
* Tcl/Tk, gawk and <1>:                  Some Applications and Techniques.
                                                             (line 1977)
* Tcl/Tk, gawk and:                      Using Networking.   (line  432)
* TCP (Transmission Control Protocol) <1>: File /inet/tcp.   (line  647)
* TCP (Transmission Control Protocol):   Using Networking.   (line  437)
* TCP (Transmission Control Protocol), connection, establishing: TCP Connecting.
                                                             (line  781)
* TCP (Transmission Control Protocol), UDP and: Interacting. (line  952)
* TCP/IP, protocols, selecting:          Special File Fields.
                                                             (line  511)
* TCP/IP, sockets and:                   Gawk Special Files. (line  475)
* Transmission Control Protocol, See TCP: Using Networking.  (line  437)
* troubleshooting, gawk, networks:       Caveats.            (line 1791)
* troubleshooting, networks, connections: Troubleshooting.   (line  834)
* troubleshooting, networks, timeouts:   Caveats.            (line 1803)
* UDP (User Datagram Protocol):          File /inet/udp.     (line  679)
* UDP (User Datagram Protocol), TCP and: Interacting.        (line  952)
* Unix, network ports and:               Setting Up.         (line  996)
* URLCHK program:                        URLCHK.             (line 2225)
* User Datagram Protocol, See UDP:       File /inet/udp.     (line  679)
* vertical bar (|), |& operator (I/O):   TCP Connecting.     (line  800)
* VRML:                                  MAZE.               (line 2634)
* web browsers, See web service:         Interacting Service.
                                                             (line 1214)
* web pages:                             Web page.           (line 1090)
* web pages, images in:                  Interacting Service.
                                                             (line 1396)
* web pages, retrieving:                 GETURL.             (line 2050)
* web servers:                           Simple Server.      (line 1601)
* web service <1>:                       PANIC.              (line 2008)
* web service:                           Primitive Service.  (line 1156)
* WEBGRAB program:                       WEBGRAB.            (line 2306)
* Weizenbaum, Joseph:                    Simple Server.      (line 1606)
* XBM image format:                      Interacting Service.
                                                             (line 1396)
* Yahoo! <1>:                            STOXPRED.           (line 3051)
* Yahoo!:                                REMCONF.            (line 2107)
* | (vertical bar), |& operator (I/O):   TCP Connecting.     (line  800)



Tag Table:
Node: Top2000
Node: Preface5688
Node: Introduction7063
Node: Stream Communications8088
Node: Datagram Communications9261
Node: The TCP/IP Protocols10892
Ref: The TCP/IP Protocols-Footnote-111576
Node: Basic Protocols11733
Node: Ports13055
Node: Making Connections14460
Ref: Making Connections-Footnote-117027
Ref: Making Connections-Footnote-217074
Node: Using Networking17255
Node: Gawk Special Files19609
Node: Special File Fields21609
Ref: table-inet-components25353
Node: Comparing Protocols28235
Node: File /inet/tcp28824
Node: File /inet/udp29844
Node: File /inet/raw30959
Ref: File /inet/raw-Footnote-133974
Node: TCP Connecting34051
Node: Troubleshooting36380
Ref: Troubleshooting-Footnote-139424
Node: Interacting39964
Node: Setting Up42684
Node: Email46166
Node: Web page48485
Ref: Web page-Footnote-151272
Node: Primitive Service51466
Node: Interacting Service54194
Ref: Interacting Service-Footnote-163291
Node: CGI Lib63320
Node: Simple Server70269
Ref: Simple Server-Footnote-177975
Node: Caveats78073
Node: Challenges79213
Node: Some Applications and Techniques87874
Node: PANIC90322
Node: GETURL92034
Node: REMCONF94650
Node: URLCHK100114
Node: WEBGRAB103937
Node: STATIST108367
Ref: STATIST-Footnote-1120029
Node: MAZE120471
Node: MOBAGWHO126646
Ref: MOBAGWHO-Footnote-1140547
Node: STOXPRED140599
Node: PROTBASE154809
Node: Links167844
Node: GNU Free Documentation License171278
Node: Index193666

End Tag Table







www.fiveanddime.net








Google
Web www.fiveanddime.net